Incidental Mutation 'R2331:Uhrf1'
ID245886
Institutional Source Beutler Lab
Gene Symbol Uhrf1
Ensembl Gene ENSMUSG00000001228
Gene Nameubiquitin-like, containing PHD and RING finger domains, 1
SynonymsICBP90, Np95
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2331 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location56303321-56323486 bp(+) (GRCm38)
Type of Mutationsplice site
DNA Base Change (assembly) C to A at 56310671 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125830 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001258] [ENSMUST00000113035] [ENSMUST00000113038] [ENSMUST00000113039] [ENSMUST00000142387]
Predicted Effect probably null
Transcript: ENSMUST00000001258
SMART Domains Protein: ENSMUSP00000001258
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113035
SMART Domains Protein: ENSMUSP00000108658
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113038
SMART Domains Protein: ENSMUSP00000108661
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:DUF3590 136 232 1.1e-42 PFAM
PHD 314 361 6.39e-12 SMART
RING 315 360 1.09e0 SMART
low complexity region 373 390 N/A INTRINSIC
SRA 411 582 8.5e-113 SMART
low complexity region 627 645 N/A INTRINSIC
RING 705 743 8.43e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000113039
SMART Domains Protein: ENSMUSP00000108662
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Pfam:TTD 128 281 8e-61 PFAM
PHD 322 369 6.39e-12 SMART
RING 323 368 1.09e0 SMART
low complexity region 381 398 N/A INTRINSIC
SRA 419 590 8.5e-113 SMART
low complexity region 635 653 N/A INTRINSIC
RING 713 751 8.43e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137876
Predicted Effect probably null
Transcript: ENSMUST00000142387
SMART Domains Protein: ENSMUSP00000125830
Gene: ENSMUSG00000001228

DomainStartEndE-ValueType
UBQ 1 74 9.37e-10 SMART
Meta Mutation Damage Score 0.646 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of RING-finger type E3 ubiquitin ligases. The protein binds to specific DNA sequences, and recruits a histone deacetylase to regulate gene expression. Its expression peaks at late G1 phase and continues during G2 and M phases of the cell cycle. It plays a major role in the G1/S transition by regulating topoisomerase IIalpha and retinoblastoma gene expression, and functions in the p53-dependent DNA damage checkpoint. It is regarded as a hub protein for the integration of epigenetic information. This gene is up-regulated in various cancers, and it is therefore considered to be a therapeutic target. Multiple transcript variants encoding different isoforms have been found for this gene. A related pseudogene exists on chromosome 12. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for disruption of this marker die early in gestation showing growth retardation and various malformations. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 26 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aff3 C T 1: 38,204,890 probably null Het
Cadps A G 14: 12,603,692 I376T probably damaging Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Gm10295 A C 7: 71,350,689 S48A unknown Het
Gstcd A G 3: 132,998,880 C538R probably damaging Het
Hcn3 A T 3: 89,148,090 S617T probably benign Het
Hectd4 A G 5: 121,320,026 I752V probably benign Het
Itgb7 G T 15: 102,223,548 T200K probably damaging Het
Lcn11 C A 2: 25,780,176 T177K possibly damaging Het
Lsm14a A G 7: 34,357,490 V241A probably benign Het
Magi1 T C 6: 93,685,562 K1075E probably damaging Het
Olfr1216 T C 2: 89,013,921 I48V probably benign Het
Olfr1426 C A 19: 12,088,158 L211F probably benign Het
P4hb T C 11: 120,568,280 N129S probably benign Het
Piezo1 C T 8: 122,487,266 probably null Het
Ppp3ca T C 3: 136,797,819 M51T probably benign Het
Sema6d T C 2: 124,658,063 V353A probably damaging Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
Sh3rf1 C T 8: 61,226,287 P121L probably benign Het
Sh3rf2 T C 18: 42,053,863 F16L probably benign Het
Sparcl1 A G 5: 104,085,794 L563P probably damaging Het
Stra6l T C 4: 45,858,224 probably null Het
Sult2a6 A T 7: 14,225,870 M246K possibly damaging Het
Trpv5 A G 6: 41,659,968 S399P probably damaging Het
Uggt2 A T 14: 119,026,599 F1006L possibly damaging Het
Wdr72 A G 9: 74,148,326 Y279C probably damaging Het
Other mutations in Uhrf1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00560:Uhrf1 APN 17 56318125 missense probably damaging 1.00
IGL00925:Uhrf1 APN 17 56320535 missense probably benign 0.00
IGL01432:Uhrf1 APN 17 56318250 missense probably damaging 1.00
IGL02739:Uhrf1 APN 17 56305129 missense probably benign 0.03
R0667:Uhrf1 UTSW 17 56310677 missense probably benign 0.01
R0685:Uhrf1 UTSW 17 56310742 missense probably damaging 0.99
R1121:Uhrf1 UTSW 17 56312917 missense probably benign
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R1462:Uhrf1 UTSW 17 56318035 missense probably damaging 1.00
R2088:Uhrf1 UTSW 17 56318089 missense probably damaging 1.00
R2329:Uhrf1 UTSW 17 56310671 splice site probably null
R2332:Uhrf1 UTSW 17 56310671 splice site probably null
R3624:Uhrf1 UTSW 17 56317023 missense probably damaging 1.00
R4065:Uhrf1 UTSW 17 56318020 missense probably damaging 1.00
R4882:Uhrf1 UTSW 17 56309401 missense probably damaging 1.00
R4901:Uhrf1 UTSW 17 56310834 missense probably benign 0.01
R4913:Uhrf1 UTSW 17 56315478 missense probably damaging 0.99
R5061:Uhrf1 UTSW 17 56320542 splice site probably null
R5186:Uhrf1 UTSW 17 56318340 missense probably damaging 1.00
R5711:Uhrf1 UTSW 17 56320259 missense possibly damaging 0.49
R6917:Uhrf1 UTSW 17 56309574 missense probably damaging 1.00
R7021:Uhrf1 UTSW 17 56320450 missense probably benign 0.04
R7241:Uhrf1 UTSW 17 56315193 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCAGAGGTCTCTTGCAGATG -3'
(R):5'- GGCACTCACTCATCATACTTGAC -3'

Sequencing Primer
(F):5'- CATCCAGTGTCCATAGTGCTGAG -3'
(R):5'- CACTCATCATACTTGACATGGTAC -3'
Posted On2014-10-30