Incidental Mutation 'R2348:Vps37c'
ID246043
Institutional Source Beutler Lab
Gene Symbol Vps37c
Ensembl Gene ENSMUSG00000048832
Gene Namevacuolar protein sorting 37C
Synonyms
MMRRC Submission 040330-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R2348 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location10688815-10714419 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 10706300 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 29 (S29P)
Ref Sequence ENSEMBL: ENSMUSP00000085264 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087951]
Predicted Effect probably damaging
Transcript: ENSMUST00000087951
AA Change: S29P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000085264
Gene: ENSMUSG00000048832
AA Change: S29P

DomainStartEndE-ValueType
Pfam:Mod_r 5 150 2.4e-39 PFAM
low complexity region 171 216 N/A INTRINSIC
low complexity region 233 250 N/A INTRINSIC
low complexity region 310 338 N/A INTRINSIC
Meta Mutation Damage Score 0.156 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 100% (31/31)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] VPS37C is a subunit of ESCRT-I (endosomal sorting complex required for transport I), a complex in the class E vacuolar protein sorting (VPS) pathway required for sorting ubiquitinated transmembrane proteins into internal vesicles of multivesicular bodies (Eastman et al., 2005 [PubMed 15509564]).[supplied by OMIM, Mar 2008]
Allele List at MGI
Other mutations in this stock
Total: 27 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810403A07Rik T C 3: 88,708,876 S457P probably benign Het
Adcyap1 A G 17: 93,202,274 D51G possibly damaging Het
Ano3 A G 2: 110,783,743 I205T possibly damaging Het
Arhgap10 A T 8: 77,450,926 probably benign Het
Asb18 T G 1: 90,014,534 D15A probably damaging Het
Atm C A 9: 53,492,268 S1368I possibly damaging Het
Atp9a A T 2: 168,710,826 probably benign Het
C2cd3 T C 7: 100,413,366 V653A probably damaging Het
Ctc1 T A 11: 69,026,191 S304T probably benign Het
Dennd4c G A 4: 86,811,527 V789I probably benign Het
Dlgap4 C A 2: 156,701,206 D176E possibly damaging Het
Hdac5 T C 11: 102,200,014 T747A probably benign Het
Htr2a A T 14: 74,645,110 N179Y probably damaging Het
Ift52 T C 2: 163,045,257 V393A probably damaging Het
Itch T C 2: 155,209,078 S562P possibly damaging Het
Kiss1r G T 10: 79,921,820 R336L probably benign Het
Klra13-ps A T 6: 130,291,308 noncoding transcript Het
Krt8 T C 15: 101,998,865 D261G probably benign Het
Mycl A T 4: 122,996,952 T144S probably benign Het
Naip5 C T 13: 100,219,738 R1123K probably benign Het
Olfr1484 A T 19: 13,586,189 E295V probably damaging Het
Rasip1 T G 7: 45,629,083 probably null Het
Rc3h1 C A 1: 160,950,860 R452S probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tpk1 A G 6: 43,346,844 S224P probably damaging Het
Vmn2r88 A T 14: 51,414,004 K258N probably benign Het
Zfp457 T A 13: 67,293,404 D369V probably benign Het
Other mutations in Vps37c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01458:Vps37c APN 19 10710417 missense probably damaging 0.99
R0433:Vps37c UTSW 19 10713029 missense probably benign
R2483:Vps37c UTSW 19 10706205 splice site probably null
R3623:Vps37c UTSW 19 10706205 splice site probably null
R3714:Vps37c UTSW 19 10706268 missense probably damaging 1.00
R4650:Vps37c UTSW 19 10712909 missense probably benign 0.31
R4684:Vps37c UTSW 19 10712768 missense probably benign
R7000:Vps37c UTSW 19 10710329 missense probably damaging 1.00
R7026:Vps37c UTSW 19 10706268 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCAAGGTGTTCCCAGAGACC -3'
(R):5'- AAGCATGAATCCTTGACAAGC -3'

Sequencing Primer
(F):5'- TGTTCCCAGAGACCCTCGTG -3'
(R):5'- TAACTCTAGTTCCAGGGAGTCCAG -3'
Posted On2014-10-30