Incidental Mutation 'R2350:Dqx1'
ID246056
Institutional Source Beutler Lab
Gene Symbol Dqx1
Ensembl Gene ENSMUSG00000009145
Gene NameDEAQ RNA-dependent ATPase
Synonyms
MMRRC Submission 040332-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R2350 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location83057844-83067318 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 83059087 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 133 (C133*)
Ref Sequence ENSEMBL: ENSMUSP00000144697 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077502] [ENSMUST00000089645] [ENSMUST00000092618] [ENSMUST00000113962] [ENSMUST00000113963] [ENSMUST00000122955] [ENSMUST00000204803]
Predicted Effect probably null
Transcript: ENSMUST00000077502
AA Change: C133*
SMART Domains Protein: ENSMUSP00000076708
Gene: ENSMUSG00000009145
AA Change: C133*

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 5.01e-4 SMART
low complexity region 268 280 N/A INTRINSIC
low complexity region 288 301 N/A INTRINSIC
HA2 441 530 4e-19 SMART
Pfam:OB_NTP_bind 555 674 2.2e-11 PFAM
low complexity region 695 708 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000089645
SMART Domains Protein: ENSMUSP00000087073
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 341 1.1e-14 PFAM
Pfam:Trypsin_2 182 320 1.2e-34 PFAM
PDZ 371 445 2.86e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000092618
SMART Domains Protein: ENSMUSP00000090281
Gene: ENSMUSG00000068328

DomainStartEndE-ValueType
low complexity region 10 40 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
PlsC 119 222 1.04e-1 SMART
low complexity region 307 322 N/A INTRINSIC
CUE 325 366 1.3e-9 SMART
low complexity region 378 392 N/A INTRINSIC
low complexity region 421 439 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113962
SMART Domains Protein: ENSMUSP00000109595
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin_2 182 237 2.7e-12 PFAM
Pfam:Trypsin 212 277 4.5e-6 PFAM
PDZ 285 348 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113963
SMART Domains Protein: ENSMUSP00000109596
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 342 6.8e-15 PFAM
Pfam:Trypsin_2 182 320 7.1e-24 PFAM
PDZ 350 413 4.89e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122955
SMART Domains Protein: ENSMUSP00000138153
Gene: ENSMUSG00000068329

DomainStartEndE-ValueType
low complexity region 28 39 N/A INTRINSIC
transmembrane domain 106 125 N/A INTRINSIC
low complexity region 128 143 N/A INTRINSIC
Pfam:Trypsin 170 321 2.1e-10 PFAM
Pfam:Trypsin_2 182 317 9.5e-21 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154829
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203123
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203180
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203331
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203749
Predicted Effect probably benign
Transcript: ENSMUST00000203915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204209
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204281
Predicted Effect probably benign
Transcript: ENSMUST00000204343
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204383
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204385
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204510
Predicted Effect probably benign
Transcript: ENSMUST00000204719
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204752
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204761
Predicted Effect probably null
Transcript: ENSMUST00000204803
AA Change: C133*
SMART Domains Protein: ENSMUSP00000144697
Gene: ENSMUSG00000009145
AA Change: C133*

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
DEXDc 30 236 2.1e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204895
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205042
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205152
Meta Mutation Damage Score 0.6244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 100% (40/40)
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A C 6: 121,678,088 probably benign Het
Adam12 T C 7: 133,919,524 T312A probably damaging Het
Adamts20 C T 15: 94,283,916 C1632Y probably damaging Het
Ago2 T C 15: 73,119,461 M543V probably benign Het
Alpk3 T C 7: 81,094,970 L1271P probably damaging Het
Arpin T A 7: 79,931,805 K56* probably null Het
Ccdc138 G T 10: 58,561,893 probably benign Het
Ccdc63 A T 5: 122,122,885 M192K probably benign Het
Cldn12 A T 5: 5,507,845 V194D possibly damaging Het
Cntnap5b T C 1: 100,379,126 L485P probably damaging Het
Cpne7 A G 8: 123,124,469 D165G probably damaging Het
Cyp2j6 A T 4: 96,529,408 M326K probably damaging Het
D630003M21Rik T A 2: 158,201,011 T870S probably damaging Het
Dennd2c A G 3: 103,132,001 D155G probably benign Het
Dnah3 A T 7: 120,045,788 probably null Het
Fam234b T A 6: 135,231,724 V545E probably damaging Het
Flcn T C 11: 59,792,659 H564R probably damaging Het
Gsdmc4 T A 15: 63,893,165 H348L probably benign Het
Gucy2c G T 6: 136,763,074 P252T probably damaging Het
Insl6 T A 19: 29,325,245 E24V possibly damaging Het
Irx1 T A 13: 71,960,048 T172S probably damaging Het
Mocos C T 18: 24,666,656 probably benign Het
Myom2 T C 8: 15,108,835 V837A probably benign Het
Nfatc2ip T C 7: 126,395,998 N126S probably benign Het
Nfix CAAAAA CAAAA 8: 84,716,247 probably null Het
Npepl1 T C 2: 174,111,773 S166P probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Olfr867 G T 9: 20,055,088 A125D probably damaging Het
Otop2 T G 11: 115,326,850 C171G probably damaging Het
Parpbp C A 10: 88,133,088 probably benign Het
Pcdhb20 T A 18: 37,504,510 S30T probably benign Het
Phkg1 A T 5: 129,864,532 V359E probably damaging Het
Ppp2cb A G 8: 33,611,827 D131G probably null Het
Scn9a A G 2: 66,504,968 Y1226H probably damaging Het
Unc5b A G 10: 60,778,200 F290S probably benign Het
Vmn1r71 A G 7: 10,747,919 F215L probably benign Het
Vmn2r101 T C 17: 19,589,783 V277A probably benign Het
Vmn2r6 T C 3: 64,556,352 S354G probably benign Het
Zfp292 A T 4: 34,811,281 S588T probably damaging Het
Other mutations in Dqx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01796:Dqx1 APN 6 83066427 unclassified probably benign
IGL02158:Dqx1 APN 6 83058910 splice site probably benign
IGL02288:Dqx1 APN 6 83060328 missense probably damaging 0.98
IGL02801:Dqx1 APN 6 83060495 unclassified probably null
IGL02929:Dqx1 APN 6 83060484 unclassified probably benign
R0396:Dqx1 UTSW 6 83059005 missense probably benign 0.00
R0448:Dqx1 UTSW 6 83060345 missense probably damaging 1.00
R0471:Dqx1 UTSW 6 83059426 splice site probably benign
R1022:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1023:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1024:Dqx1 UTSW 6 83061089 missense probably damaging 1.00
R1480:Dqx1 UTSW 6 83059452 missense possibly damaging 0.61
R1804:Dqx1 UTSW 6 83060322 missense probably damaging 1.00
R1848:Dqx1 UTSW 6 83066107 missense probably damaging 1.00
R1982:Dqx1 UTSW 6 83058577 missense probably damaging 1.00
R2064:Dqx1 UTSW 6 83058543 unclassified probably benign
R3110:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3112:Dqx1 UTSW 6 83058972 missense probably damaging 0.99
R3119:Dqx1 UTSW 6 83066235 nonsense probably null
R4179:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4180:Dqx1 UTSW 6 83059479 missense probably benign 0.03
R4873:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4875:Dqx1 UTSW 6 83061012 missense probably benign 0.25
R4882:Dqx1 UTSW 6 83066088 critical splice acceptor site probably null
R5015:Dqx1 UTSW 6 83066111 missense probably benign 0.00
R5128:Dqx1 UTSW 6 83060567 missense probably damaging 0.96
R5346:Dqx1 UTSW 6 83059719 missense possibly damaging 0.87
R5480:Dqx1 UTSW 6 83064803 missense probably damaging 0.98
R6939:Dqx1 UTSW 6 83059465 missense probably damaging 0.99
R6979:Dqx1 UTSW 6 83061011 missense probably damaging 1.00
R7059:Dqx1 UTSW 6 83064809 missense probably benign 0.18
R7084:Dqx1 UTSW 6 83066455 missense probably damaging 1.00
R7354:Dqx1 UTSW 6 83060976 nonsense probably null
R7389:Dqx1 UTSW 6 83064794 missense probably null 0.99
Predicted Primers PCR Primer
(F):5'- ATTCCTCAGTGGTGTGCAGAG -3'
(R):5'- CCTGTGGACCATTAAGTGTGATC -3'

Sequencing Primer
(F):5'- AGTTTGCGCTGGCCAGAG -3'
(R):5'- GTGATCCCACATCTCTGTTGAGAG -3'
Posted On2014-10-30