Incidental Mutation 'R2351:Ino80d'
ID246091
Institutional Source Beutler Lab
Gene Symbol Ino80d
Ensembl Gene ENSMUSG00000040865
Gene NameINO80 complex subunit D
SynonymsA430093A21Rik
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.481) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location62958418-63114667 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 63085835 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 156 (L156H)
Ref Sequence ENSEMBL: ENSMUSP00000127378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097718] [ENSMUST00000133236] [ENSMUST00000137511] [ENSMUST00000153992] [ENSMUST00000165066] [ENSMUST00000172416]
Predicted Effect probably benign
Transcript: ENSMUST00000097718
AA Change: L156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095325
Gene: ENSMUSG00000040865
AA Change: L156H

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133236
AA Change: L156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000123430
Gene: ENSMUSG00000040865
AA Change: L156H

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 337 401 4.3e-20 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137511
AA Change: L156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000119118
Gene: ENSMUSG00000040865
AA Change: L156H

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 438 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000153992
AA Change: L156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000115332
Gene: ENSMUSG00000040865
AA Change: L156H

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 4.3e-23 PFAM
low complexity region 414 431 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000165066
AA Change: L261H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000130864
Gene: ENSMUSG00000040865
AA Change: L261H

DomainStartEndE-ValueType
Pfam:zf-C3Hc3H 18 79 5.9e-21 PFAM
low complexity region 196 206 N/A INTRINSIC
low complexity region 258 263 N/A INTRINSIC
low complexity region 354 365 N/A INTRINSIC
low complexity region 419 430 N/A INTRINSIC
Pfam:zf-C3Hc3H 442 506 7e-21 PFAM
low complexity region 519 564 N/A INTRINSIC
low complexity region 640 654 N/A INTRINSIC
low complexity region 752 771 N/A INTRINSIC
low complexity region 811 827 N/A INTRINSIC
low complexity region 907 926 N/A INTRINSIC
low complexity region 995 1016 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172416
AA Change: L156H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127378
Gene: ENSMUSG00000040865
AA Change: L156H

DomainStartEndE-ValueType
low complexity region 91 101 N/A INTRINSIC
low complexity region 153 158 N/A INTRINSIC
low complexity region 249 260 N/A INTRINSIC
low complexity region 314 325 N/A INTRINSIC
Pfam:zf-C3Hc3H 336 402 1.2e-22 PFAM
low complexity region 414 459 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 647 666 N/A INTRINSIC
low complexity region 706 722 N/A INTRINSIC
low complexity region 802 821 N/A INTRINSIC
low complexity region 890 911 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Ino80d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00813:Ino80d APN 1 63093303 missense probably damaging 1.00
IGL01552:Ino80d APN 1 63057977 utr 3 prime probably benign
IGL01960:Ino80d APN 1 63058147 missense probably damaging 0.98
IGL02374:Ino80d APN 1 63086061 missense possibly damaging 0.63
IGL03201:Ino80d APN 1 63058308 missense probably damaging 1.00
IGL03248:Ino80d APN 1 63068182 critical splice donor site probably null
R0153:Ino80d UTSW 1 63058318 missense probably damaging 0.97
R0371:Ino80d UTSW 1 63057956 utr 3 prime probably benign
R0416:Ino80d UTSW 1 63086276 missense possibly damaging 0.93
R1738:Ino80d UTSW 1 63093465 missense probably damaging 1.00
R2341:Ino80d UTSW 1 63065826 missense possibly damaging 0.75
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R2870:Ino80d UTSW 1 63061039 critical splice donor site probably null
R3814:Ino80d UTSW 1 63074424 missense probably benign 0.05
R3828:Ino80d UTSW 1 63062078 missense possibly damaging 0.94
R3947:Ino80d UTSW 1 63074503 missense probably benign 0.16
R3949:Ino80d UTSW 1 63074503 missense probably benign 0.16
R5180:Ino80d UTSW 1 63086329 start gained probably benign
R5301:Ino80d UTSW 1 63074419 missense probably benign
R5338:Ino80d UTSW 1 63058939 missense probably benign 0.34
R5634:Ino80d UTSW 1 63062283 intron probably benign
R5716:Ino80d UTSW 1 63058697 missense probably benign 0.01
R5841:Ino80d UTSW 1 63058840 missense probably damaging 1.00
R6219:Ino80d UTSW 1 63079047 missense possibly damaging 0.88
R6222:Ino80d UTSW 1 63058525 missense probably damaging 0.99
R6283:Ino80d UTSW 1 63062126 missense probably damaging 1.00
R6720:Ino80d UTSW 1 63058610 missense probably damaging 1.00
R6835:Ino80d UTSW 1 63074326 missense probably benign
R6897:Ino80d UTSW 1 63065834 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCCAGGAAAGGAGGCCAAC -3'
(R):5'- AGTTCGGCAAGAGCACTTTAGC -3'

Sequencing Primer
(F):5'- AGTTTCACCAGTCTCTGC -3'
(R):5'- GAGCACTTTAGCACCCCTC -3'
Posted On2014-10-30