Incidental Mutation 'R2351:Grm8'
ID246124
Institutional Source Beutler Lab
Gene Symbol Grm8
Ensembl Gene ENSMUSG00000024211
Gene Nameglutamate receptor, metabotropic 8
SynonymsmGluR8, Gprc1h
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.358) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location27275119-28135178 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 28126119 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 3 (C3S)
Ref Sequence ENSEMBL: ENSMUSP00000118098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090512] [ENSMUST00000115323] [ENSMUST00000115324] [ENSMUST00000131897] [ENSMUST00000132755]
Predicted Effect probably benign
Transcript: ENSMUST00000090512
AA Change: C3S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000087998
Gene: ENSMUSG00000024211
AA Change: C3S

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 9.6e-102 PFAM
Pfam:Peripla_BP_6 141 375 1.3e-9 PFAM
Pfam:NCD3G 512 562 5e-17 PFAM
Pfam:7tm_3 593 841 4.7e-88 PFAM
low complexity region 887 905 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115323
AA Change: C3S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110978
Gene: ENSMUSG00000024211
AA Change: C3S

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 3.3e-107 PFAM
Pfam:NCD3G 512 562 9e-14 PFAM
Pfam:7tm_3 595 840 6.8e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115324
AA Change: C3S

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000110979
Gene: ENSMUSG00000024211
AA Change: C3S

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 478 2.1e-101 PFAM
Pfam:Peripla_BP_6 141 375 9.2e-10 PFAM
Pfam:NCD3G 512 562 2.8e-16 PFAM
Pfam:7tm_3 593 841 2.4e-87 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131897
AA Change: C3S

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000120394
Gene: ENSMUSG00000024211
AA Change: C3S

DomainStartEndE-ValueType
Pfam:ANF_receptor 74 294 5.8e-66 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132755
AA Change: C3S

PolyPhen 2 Score 0.663 (Sensitivity: 0.86; Specificity: 0.91)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146727
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele are overweight and mildly insulin resistant, and display increased anxiety-related responses and reduced exploration in a new environment. Mice homozygous for a different knock-out allele exhibit altered excitatory responses in the dentate gyrus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Grm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01310:Grm8 APN 6 27363801 missense probably damaging 1.00
IGL01412:Grm8 APN 6 27762461 missense probably damaging 1.00
IGL02329:Grm8 APN 6 27363116 missense probably damaging 1.00
IGL02342:Grm8 APN 6 27363804 missense probably benign 0.00
IGL02584:Grm8 APN 6 27762439 missense probably benign 0.35
IGL03040:Grm8 APN 6 28126123 start codon destroyed probably null 0.01
IGL03112:Grm8 APN 6 27363263 missense probably damaging 1.00
IGL03139:Grm8 APN 6 27618650 missense probably damaging 1.00
IGL03287:Grm8 APN 6 27760255 missense possibly damaging 0.86
R0137:Grm8 UTSW 6 27762390 missense probably damaging 0.99
R0266:Grm8 UTSW 6 27285896 missense probably damaging 1.00
R0347:Grm8 UTSW 6 27981222 missense probably benign 0.37
R0580:Grm8 UTSW 6 27761371 splice site probably benign
R0698:Grm8 UTSW 6 27363914 missense probably damaging 1.00
R0833:Grm8 UTSW 6 27363179 missense probably damaging 1.00
R1301:Grm8 UTSW 6 27981201 missense possibly damaging 0.94
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1323:Grm8 UTSW 6 28125974 missense probably damaging 1.00
R1471:Grm8 UTSW 6 27363309 missense possibly damaging 0.79
R1554:Grm8 UTSW 6 28125853 missense probably benign 0.01
R1638:Grm8 UTSW 6 28125883 nonsense probably null
R1763:Grm8 UTSW 6 27285867 missense possibly damaging 0.79
R1899:Grm8 UTSW 6 28125895 missense probably damaging 1.00
R1902:Grm8 UTSW 6 27429482 missense probably damaging 1.00
R1916:Grm8 UTSW 6 27363584 missense probably benign 0.01
R2257:Grm8 UTSW 6 27760225 missense probably damaging 0.98
R2396:Grm8 UTSW 6 27761242 missense probably damaging 0.98
R3801:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3802:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3803:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3804:Grm8 UTSW 6 28125636 missense possibly damaging 0.95
R3830:Grm8 UTSW 6 27761229 nonsense probably null
R3844:Grm8 UTSW 6 27429508 missense possibly damaging 0.69
R4006:Grm8 UTSW 6 27981230 missense probably damaging 1.00
R4077:Grm8 UTSW 6 27760209 missense probably benign 0.01
R4395:Grm8 UTSW 6 27429432 missense probably damaging 0.98
R4436:Grm8 UTSW 6 27761238 missense possibly damaging 0.48
R4810:Grm8 UTSW 6 27761296 missense possibly damaging 0.87
R5357:Grm8 UTSW 6 27762419 missense probably damaging 1.00
R5677:Grm8 UTSW 6 27761204 critical splice donor site probably null
R5983:Grm8 UTSW 6 27760221 missense probably benign 0.03
R5990:Grm8 UTSW 6 27363624 missense probably damaging 1.00
R6365:Grm8 UTSW 6 27363227 missense probably damaging 1.00
R6454:Grm8 UTSW 6 27363776 missense possibly damaging 0.68
R6713:Grm8 UTSW 6 27363191 missense probably damaging 1.00
R6960:Grm8 UTSW 6 27981282 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- AGTCTGTGGATGCCCTTTTC -3'
(R):5'- GGAGGATCTGTTGGAAATTCACTG -3'

Sequencing Primer
(F):5'- TCTTCAGGTCCCCACAAGG -3'
(R):5'- GATCTGTTGGAAATTCACTGTGAAG -3'
Posted On2014-10-30