Incidental Mutation 'R0284:Olfr251'
ID24613
Institutional Source Beutler Lab
Gene Symbol Olfr251
Ensembl Gene ENSMUSG00000096757
Gene Nameolfactory receptor 251
SynonymsMOR170-15, GA_x6K02T2MYUG-9124-8183
MMRRC Submission 038505-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R0284 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38377086-38382474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 38378584 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 234 (M234I)
Ref Sequence ENSEMBL: ENSMUSP00000072514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072731] [ENSMUST00000214865]
Predicted Effect probably benign
Transcript: ENSMUST00000072731
AA Change: M234I

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000072514
Gene: ENSMUSG00000096757
AA Change: M234I

DomainStartEndE-ValueType
Pfam:7tm_4 37 313 9.8e-50 PFAM
Pfam:7tm_1 47 296 4.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000214865
AA Change: M228I

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 95.9%
  • 20x: 92.4%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 62 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110017D15Rik T G 4: 41,507,538 E150A probably damaging Het
Akap2 T C 4: 57,855,207 F220L probably damaging Het
Alkbh6 A G 7: 30,313,988 T161A probably benign Het
Alox12e A G 11: 70,320,899 probably benign Het
Ap1g2 A G 14: 55,101,692 probably benign Het
Arid2 A T 15: 96,378,967 probably benign Het
Bmp2k A T 5: 97,068,455 H604L unknown Het
Cacna1a A T 8: 84,612,285 M1705L probably damaging Het
Cacna1d A T 14: 30,072,105 D1526E probably damaging Het
Ccdc171 A G 4: 83,549,738 R107G possibly damaging Het
Cklf T C 8: 104,261,575 probably benign Het
Crabp1 A G 9: 54,764,926 K9E probably benign Het
Cspg4 A G 9: 56,886,139 D386G probably damaging Het
Cyp3a41b G A 5: 145,578,204 probably benign Het
Dsg1a T A 18: 20,331,627 V393E probably damaging Het
Ednrb C T 14: 103,820,013 G371D probably damaging Het
Efcab5 T C 11: 77,103,527 probably benign Het
Exoc2 A T 13: 30,877,625 probably benign Het
Fbn2 G A 18: 58,050,290 probably benign Het
Foxo6 T C 4: 120,269,002 S199G probably benign Het
Fpr1 T A 17: 17,877,356 I124F probably damaging Het
Gk5 A T 9: 96,181,770 probably null Het
Gys1 A T 7: 45,436,719 probably benign Het
Igfbp1 T C 11: 7,198,103 S49P probably damaging Het
Incenp A T 19: 9,893,993 S91T unknown Het
Itpkc G A 7: 27,214,543 R498* probably null Het
Kat6a A G 8: 22,939,803 T1725A unknown Het
Kiz T A 2: 146,863,810 C97S probably benign Het
Kri1 A G 9: 21,276,552 probably benign Het
Lipn A G 19: 34,080,706 S276G possibly damaging Het
Llgl1 A G 11: 60,712,141 T881A probably damaging Het
Man1a2 T C 3: 100,684,786 H26R probably damaging Het
Map3k5 T A 10: 20,000,613 F173I probably damaging Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mipol1 A G 12: 57,457,069 Q341R probably damaging Het
Mllt6 G T 11: 97,678,605 A928S probably benign Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nipsnap3a C T 4: 52,997,178 T150I probably benign Het
Nsl1 A G 1: 191,065,230 E97G probably damaging Het
Olfr1278 T C 2: 111,292,586 V106A probably benign Het
Olfr736 G A 14: 50,392,995 V80M probably damaging Het
Olfr830 A T 9: 18,875,552 Y72F probably benign Het
Pdcd6ip A G 9: 113,662,504 L552S probably damaging Het
Plekhf2 T C 4: 10,990,595 probably benign Het
Prdm1 T C 10: 44,456,626 E96G probably damaging Het
Prpf40a T A 2: 53,150,647 E608D probably damaging Het
Prpf40b A T 15: 99,316,393 probably benign Het
Rag2 T C 2: 101,630,119 V258A probably damaging Het
S100a5 A G 3: 90,611,574 I68V probably benign Het
Serpinb8 G A 1: 107,602,918 probably null Het
Slc24a4 T C 12: 102,260,481 V492A probably damaging Het
Spag6l T A 16: 16,780,766 Q287L probably damaging Het
Synpo2 C T 3: 123,079,734 W211* probably null Het
Tgtp1 A G 11: 48,987,143 V245A probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Trerf1 A G 17: 47,319,545 noncoding transcript Het
Ttn G C 2: 76,846,704 probably benign Het
Vmn1r28 G A 6: 58,265,717 A182T probably benign Het
Vps13d A T 4: 145,144,802 M1900K probably benign Het
Vps41 A T 13: 18,853,440 D691V probably damaging Het
Zfp518b T C 5: 38,671,740 Y974C probably damaging Het
Zscan29 A T 2: 121,166,733 probably benign Het
Other mutations in Olfr251
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02013:Olfr251 APN 9 38378077 missense probably benign 0.31
IGL02131:Olfr251 APN 9 38377907 missense probably benign 0.01
IGL02311:Olfr251 APN 9 38377898 nonsense probably null
IGL02377:Olfr251 APN 9 38378246 missense probably damaging 1.00
R0412:Olfr251 UTSW 9 38378794 missense probably damaging 0.98
R0903:Olfr251 UTSW 9 38378801 missense probably benign 0.00
R1664:Olfr251 UTSW 9 38378252 missense possibly damaging 0.93
R2902:Olfr251 UTSW 9 38378041 missense possibly damaging 0.89
R3970:Olfr251 UTSW 9 38377926 missense probably damaging 0.98
R4191:Olfr251 UTSW 9 38378352 missense probably damaging 0.98
R4650:Olfr251 UTSW 9 38378403 missense probably damaging 1.00
R4910:Olfr251 UTSW 9 38378742 missense probably null 0.98
R5256:Olfr251 UTSW 9 38377917 missense probably benign 0.00
R5385:Olfr251 UTSW 9 38377985 missense probably benign
R5386:Olfr251 UTSW 9 38377985 missense probably benign
R6005:Olfr251 UTSW 9 38378309 missense probably damaging 1.00
R6268:Olfr251 UTSW 9 38378088 missense probably benign 0.10
R6486:Olfr251 UTSW 9 38377904 missense probably benign
R7019:Olfr251 UTSW 9 38378802 missense possibly damaging 0.89
R7045:Olfr251 UTSW 9 38378433 missense probably damaging 0.99
R7120:Olfr251 UTSW 9 38378649 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCTGGTGCCCTGACTCATACAG -3'
(R):5'- TGGCAGTGATCAACATTCTGGAGC -3'

Sequencing Primer
(F):5'- CTCATACAGGGTTTATGATCAGGC -3'
(R):5'- aacaaagagagagaataaaGCAATGC -3'
Posted On2013-04-16