Incidental Mutation 'R2351:Atp2b2'
ID246131
Institutional Source Beutler Lab
Gene Symbol Atp2b2
Ensembl Gene ENSMUSG00000030302
Gene NameATPase, Ca++ transporting, plasma membrane 2
SynonymsPMCA2, D6Abb2e, wms, jog, Gena300, Tmy
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.600) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location113743831-114042613 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 113789757 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 552 (I552N)
Ref Sequence ENSEMBL: ENSMUSP00000098605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089003] [ENSMUST00000101044] [ENSMUST00000101045] [ENSMUST00000152831] [ENSMUST00000205052]
Predicted Effect possibly damaging
Transcript: ENSMUST00000089003
AA Change: I507N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000086398
Gene: ENSMUSG00000030302
AA Change: I507N

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101044
AA Change: I552N

PolyPhen 2 Score 0.913 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098605
Gene: ENSMUSG00000030302
AA Change: I552N

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 307 4.2e-28 PFAM
low complexity region 313 330 N/A INTRINSIC
low complexity region 337 356 N/A INTRINSIC
Pfam:E1-E2_ATPase 373 488 1.4e-13 PFAM
Pfam:Hydrolase 493 832 8.1e-16 PFAM
Pfam:HAD 496 829 6.3e-21 PFAM
Pfam:Cation_ATPase 542 638 4.4e-17 PFAM
Pfam:Hydrolase_3 791 865 8.3e-7 PFAM
transmembrane domain 878 900 N/A INTRINSIC
Pfam:Cation_ATPase_C 902 1084 2.5e-47 PFAM
low complexity region 1102 1115 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1126 1178 2.4e-30 PFAM
low complexity region 1196 1211 N/A INTRINSIC
low complexity region 1220 1234 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000101045
AA Change: I507N

PolyPhen 2 Score 0.465 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000098606
Gene: ENSMUSG00000030302
AA Change: I507N

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 1.7e-56 PFAM
Pfam:Hydrolase 448 787 3.9e-25 PFAM
Pfam:HAD 451 784 2.4e-16 PFAM
Pfam:Hydrolase_like2 497 593 9.4e-17 PFAM
Pfam:Hydrolase_3 745 820 1.7e-6 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 7.3e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1144 1.4e-31 PFAM
low complexity region 1151 1166 N/A INTRINSIC
low complexity region 1175 1189 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000152831
AA Change: I507N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000138165
Gene: ENSMUSG00000030302
AA Change: I507N

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 156 444 6.1e-57 PFAM
Pfam:Hydrolase 448 787 1.4e-25 PFAM
Pfam:HAD 451 784 7.7e-17 PFAM
Pfam:Hydrolase_like2 497 593 4.4e-17 PFAM
Pfam:Hydrolase_3 745 820 4.2e-7 PFAM
transmembrane domain 833 855 N/A INTRINSIC
Pfam:Cation_ATPase_C 857 1039 2.7e-46 PFAM
low complexity region 1057 1070 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1081 1149 1.3e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000205052
AA Change: I507N

PolyPhen 2 Score 0.856 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000145174
Gene: ENSMUSG00000030302
AA Change: I507N

DomainStartEndE-ValueType
Cation_ATPase_N 47 123 1.21e-4 SMART
Pfam:E1-E2_ATPase 155 310 1.9e-28 PFAM
Pfam:E1-E2_ATPase 328 443 1.1e-13 PFAM
Pfam:HAD 451 780 2.7e-19 PFAM
Pfam:Cation_ATPase 497 593 5.8e-17 PFAM
Pfam:Hydrolase 576 783 2e-8 PFAM
Pfam:Hydrolase_3 711 816 2.3e-7 PFAM
transmembrane domain 829 851 N/A INTRINSIC
Pfam:Cation_ATPase_C 853 1035 2.5e-47 PFAM
low complexity region 1053 1066 N/A INTRINSIC
Pfam:ATP_Ca_trans_C 1077 1129 2.6e-30 PFAM
low complexity region 1147 1162 N/A INTRINSIC
low complexity region 1171 1185 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the family of P-type primary ion transport ATPases characterized by the formation of an aspartyl phosphate intermediate during the reaction cycle. These enzymes remove bivalent calcium ions from eukaryotic cells against very large concentration gradients and play a critical role in intracellular calcium homeostasis. The mammalian plasma membrane calcium ATPase isoforms are encoded by at least four separate genes and the diversity of these enzymes is further increased by alternative splicing of transcripts. The expression of different isoforms and splice variants is regulated in a developmental, tissue- and cell type-specific manner, suggesting that these pumps are functionally adapted to the physiological needs of particular cells and tissues. This gene encodes the plasma membrane calcium ATPase isoform 2. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants exhibit slower growth, balance problems, and deafness, associated with cerebellar abnormalities, an absence of otoconia, and abnormalities of the organ of Corti. Heterozygotes exhibit appreciable age-dependent hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Traf4 G A 11: 78,160,176 R385W probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Atp2b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00802:Atp2b2 APN 6 113805515 missense possibly damaging 0.69
IGL01140:Atp2b2 APN 6 113789971 missense possibly damaging 0.94
IGL02065:Atp2b2 APN 6 113813867 missense probably damaging 1.00
IGL02267:Atp2b2 APN 6 113793730 missense probably damaging 1.00
IGL02383:Atp2b2 APN 6 113813942 missense probably damaging 0.99
IGL02498:Atp2b2 APN 6 113793854 missense probably damaging 0.99
IGL02631:Atp2b2 APN 6 113748545 missense probably damaging 1.00
IGL03028:Atp2b2 APN 6 113759142 missense probably damaging 0.99
IGL03221:Atp2b2 APN 6 113760859 splice site probably benign
IGL03290:Atp2b2 APN 6 113793754 missense probably damaging 1.00
johan UTSW 6 113773388 missense probably damaging 1.00
lohan UTSW 6 113760650 missense probably damaging 1.00
IGL02799:Atp2b2 UTSW 6 113762852 nonsense probably null
R0116:Atp2b2 UTSW 6 113793695 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0131:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0132:Atp2b2 UTSW 6 113793782 missense probably damaging 1.00
R0195:Atp2b2 UTSW 6 113793874 missense probably benign 0.07
R0421:Atp2b2 UTSW 6 113813888 missense probably damaging 1.00
R0791:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R0792:Atp2b2 UTSW 6 113773388 missense probably damaging 1.00
R1033:Atp2b2 UTSW 6 113793888 splice site probably null
R1248:Atp2b2 UTSW 6 113817192 missense probably damaging 1.00
R1524:Atp2b2 UTSW 6 113774201 splice site probably benign
R1809:Atp2b2 UTSW 6 113803743 intron probably benign
R1829:Atp2b2 UTSW 6 113773368 missense probably damaging 1.00
R1854:Atp2b2 UTSW 6 113842283 missense probably damaging 1.00
R2127:Atp2b2 UTSW 6 113760650 missense probably damaging 1.00
R2138:Atp2b2 UTSW 6 113796307 missense probably benign 0.21
R3923:Atp2b2 UTSW 6 113797108 critical splice donor site probably null
R3951:Atp2b2 UTSW 6 113760831 missense possibly damaging 0.51
R4178:Atp2b2 UTSW 6 113793718 missense probably damaging 1.00
R4353:Atp2b2 UTSW 6 113765784 missense probably benign 0.01
R4578:Atp2b2 UTSW 6 113760711 missense probably damaging 1.00
R4797:Atp2b2 UTSW 6 113789886 missense possibly damaging 0.92
R4884:Atp2b2 UTSW 6 113842186 missense possibly damaging 0.65
R4976:Atp2b2 UTSW 6 113759161 missense probably damaging 1.00
R5273:Atp2b2 UTSW 6 113759232 missense probably damaging 1.00
R5350:Atp2b2 UTSW 6 113759238 missense probably damaging 0.99
R5414:Atp2b2 UTSW 6 113842141 missense probably damaging 1.00
R5560:Atp2b2 UTSW 6 113774358 missense possibly damaging 0.90
R5589:Atp2b2 UTSW 6 113774439 missense possibly damaging 0.94
R5790:Atp2b2 UTSW 6 113759309 missense probably damaging 0.97
R6001:Atp2b2 UTSW 6 113793767 missense probably damaging 1.00
R6127:Atp2b2 UTSW 6 113813877 missense probably damaging 1.00
R6331:Atp2b2 UTSW 6 113797131 missense probably benign 0.01
R6925:Atp2b2 UTSW 6 113760720 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805499 missense probably damaging 1.00
X0020:Atp2b2 UTSW 6 113805500 missense probably damaging 1.00
Z1088:Atp2b2 UTSW 6 113842306 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTTGAGGGATCAATGGCAG -3'
(R):5'- TGCTCAGACAAGACAGGAAC -3'

Sequencing Primer
(F):5'- AGATATCTAAAACAGCAATCACCAAG -3'
(R):5'- TCAGACAAGACAGGAACGCTGAC -3'
Posted On2014-10-30