Incidental Mutation 'R2351:Traf4'
ID246150
Institutional Source Beutler Lab
Gene Symbol Traf4
Ensembl Gene ENSMUSG00000017386
Gene NameTNF receptor associated factor 4
SynonymsCART1, A530032M13Rik, msp2
MMRRC Submission 040333-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.906) question?
Stock #R2351 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location78158499-78165589 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 78160176 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 385 (R385W)
Ref Sequence ENSEMBL: ENSMUSP00000017530 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017530] [ENSMUST00000073705] [ENSMUST00000100782] [ENSMUST00000155571]
Predicted Effect probably damaging
Transcript: ENSMUST00000017530
AA Change: R385W

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017530
Gene: ENSMUSG00000017386
AA Change: R385W

DomainStartEndE-ValueType
RING 18 57 1.41e-4 SMART
Pfam:zf-TRAF 102 156 3.4e-19 PFAM
Pfam:zf-TRAF 156 210 4e-12 PFAM
Pfam:zf-TRAF 210 269 4.2e-23 PFAM
low complexity region 287 302 N/A INTRINSIC
MATH 312 445 1.04e-20 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073705
SMART Domains Protein: ENSMUSP00000073384
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 5.6e-233 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100782
SMART Domains Protein: ENSMUSP00000126620
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 1 434 1.9e-157 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148218
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149437
Predicted Effect probably benign
Transcript: ENSMUST00000155571
SMART Domains Protein: ENSMUSP00000121832
Gene: ENSMUSG00000037750

DomainStartEndE-ValueType
Pfam:FAM222A 27 562 3.2e-259 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the TNF receptor associated factor (TRAF) family. TRAF proteins are associated with, and mediate signal transduction from members of the TNF receptor superfamily. The encoded protein has been shown to interact with neurotrophin receptor, p75 (NTR/NTSR1), and negatively regulate NTR induced cell death and NF-kappa B activation. This protein has been found to bind to p47phox, a cytosolic regulatory factor included in a multi-protein complex known as NAD(P)H oxidase. This protein thus, is thought to be involved in the oxidative activation of MAPK8/JNK. Alternatively spliced transcript variants have been observed but the full-length nature of only one has been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations show respiratory problems, various skeletal defects, spina bifida and partial lethality around embryonic day 14. Homozygotes for an ENU-induced mutation exhibit postnatal lethality and hypopigmentation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 70 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310009B15Rik A T 1: 138,852,108 Y135* probably null Het
2700081O15Rik T C 19: 7,422,244 I247T probably damaging Het
9430007A20Rik A T 4: 144,528,778 Y256F probably damaging Het
Acad10 A T 5: 121,629,927 I820K probably benign Het
Arl8b A T 6: 108,821,523 I178F possibly damaging Het
Asap1 A T 15: 64,135,804 probably null Het
Atp2b2 A T 6: 113,789,757 I552N possibly damaging Het
C130074G19Rik G T 1: 184,882,863 D43E probably benign Het
Ccdc162 C A 10: 41,555,972 probably null Het
Ccdc186 T G 19: 56,798,697 K613T possibly damaging Het
Cggbp1 T A 16: 64,855,683 D37E possibly damaging Het
Cntn3 A T 6: 102,337,383 N123K possibly damaging Het
Col18a1 C T 10: 77,112,704 G325S probably benign Het
Cwc25 G T 11: 97,747,392 T405K probably damaging Het
Cyp4a31 T C 4: 115,571,313 V370A possibly damaging Het
Cyp4f13 T G 17: 32,925,596 I309L probably benign Het
Dap3 A T 3: 88,933,563 probably null Het
Dchs1 G T 7: 105,754,094 D3080E probably benign Het
Ern2 A G 7: 122,171,508 V762A probably damaging Het
Fgr C T 4: 132,997,237 R255C probably damaging Het
Gcm2 A T 13: 41,103,618 D218E probably benign Het
Gfi1 A G 5: 107,721,774 S131P probably damaging Het
Grm8 A T 6: 28,126,119 C3S possibly damaging Het
Gucy2d A G 7: 98,464,019 D840G probably benign Het
H3f3a T C 1: 180,810,158 T81A probably benign Het
Igsf23 C T 7: 19,944,798 W22* probably null Het
Il12rb2 G A 6: 67,361,944 Q3* probably null Het
Ino80d A T 1: 63,085,835 L156H probably benign Het
Kdm2a G A 19: 4,329,126 P554S probably benign Het
Lefty1 T A 1: 180,937,242 L244H possibly damaging Het
Mdn1 T A 4: 32,750,010 S4398T probably benign Het
Myh10 A G 11: 68,793,139 D1126G probably damaging Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Myom1 A T 17: 71,034,579 D111V probably damaging Het
Naip6 T A 13: 100,283,661 D1367V probably damaging Het
Nbeal1 A T 1: 60,237,098 H666L possibly damaging Het
Nsmaf T A 4: 6,437,921 I77F probably damaging Het
Nvl T C 1: 181,130,792 T231A probably benign Het
Obscn T C 11: 59,112,612 R1287G probably damaging Het
Olfr1058 C T 2: 86,386,127 C97Y probably damaging Het
Olfr1219 C T 2: 89,074,399 G231S possibly damaging Het
Olfr1254 T C 2: 89,789,178 Y58C probably damaging Het
Olfr2 A T 7: 107,001,676 Y61* probably null Het
Olfr420 T A 1: 174,158,920 V49D probably damaging Het
Olfr765 A G 10: 129,046,928 V45A probably benign Het
Opn3 T C 1: 175,692,511 D9G probably benign Het
Parp10 A T 15: 76,242,856 S101R probably benign Het
Pdhx T A 2: 103,024,217 K399* probably null Het
Pdia4 A T 6: 47,796,914 probably null Het
Pla2g4f T C 2: 120,300,442 D844G probably benign Het
Prtg C A 9: 72,856,824 D526E probably damaging Het
Rassf6 T C 5: 90,631,559 D5G probably benign Het
Riok3 C T 18: 12,149,667 Q388* probably null Het
Robo4 T A 9: 37,411,660 F825L probably benign Het
Rpl13a-ps1 C T 19: 50,030,429 E103K probably benign Het
Rpl18a A T 8: 70,896,220 H37Q probably benign Het
Ryr1 A T 7: 29,075,293 S2301T probably benign Het
Slc39a9 T A 12: 80,644,886 D2E possibly damaging Het
Slco5a1 C T 1: 12,989,934 V188I probably benign Het
Son T A 16: 91,657,659 M1098K probably damaging Het
Spag9 A G 11: 94,092,900 D701G probably damaging Het
Ssmem1 T C 6: 30,512,496 F46S possibly damaging Het
Sspo C T 6: 48,464,869 R1938W probably damaging Het
Sstr3 T C 15: 78,539,921 I209V probably benign Het
Tlk2 A G 11: 105,209,830 Y87C probably damaging Het
Triobp G A 15: 79,004,580 V1962M probably benign Het
Tspan12 T G 6: 21,835,507 I56L probably benign Het
Upp2 T A 2: 58,763,662 probably null Het
Vps13b T C 15: 35,869,311 W2654R probably damaging Het
Zc3h18 C T 8: 122,403,187 R435* probably null Het
Other mutations in Traf4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01351:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01354:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01361:Traf4 APN 11 78165400 missense possibly damaging 0.93
IGL01375:Traf4 APN 11 78160082 missense probably benign 0.00
IGL01991:Traf4 APN 11 78160046 missense possibly damaging 0.87
IGL02243:Traf4 APN 11 78160517 missense probably benign 0.00
IGL02800:Traf4 APN 11 78160235 missense possibly damaging 0.67
IGL02883:Traf4 APN 11 78161621 missense possibly damaging 0.72
R2104:Traf4 UTSW 11 78160014 missense probably damaging 0.99
R2199:Traf4 UTSW 11 78159980 missense probably damaging 1.00
R2298:Traf4 UTSW 11 78160851 missense probably benign 0.08
R4547:Traf4 UTSW 11 78161037 missense possibly damaging 0.85
R4854:Traf4 UTSW 11 78161520 nonsense probably null
R6905:Traf4 UTSW 11 78160442 missense probably benign 0.03
R6907:Traf4 UTSW 11 78160442 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- AAATGAACTTGGGGTAGCCG -3'
(R):5'- CGATGGAGTGCTCATCTGGAAG -3'

Sequencing Primer
(F):5'- AACTTGGGGTAGCCGAAGCC -3'
(R):5'- CTCATCTGGAAGATTGGCAGC -3'
Posted On2014-10-30