Incidental Mutation 'R2352:Iqgap3'
ID246182
Institutional Source Beutler Lab
Gene Symbol Iqgap3
Ensembl Gene ENSMUSG00000028068
Gene NameIQ motif containing GTPase activating protein 3
Synonyms
MMRRC Submission 040334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.398) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location88081971-88121048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88104508 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 836 (K836E)
Ref Sequence ENSEMBL: ENSMUSP00000071715 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071812] [ENSMUST00000194440] [ENSMUST00000195465]
Predicted Effect possibly damaging
Transcript: ENSMUST00000071812
AA Change: K836E

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000071715
Gene: ENSMUSG00000028068
AA Change: K836E

DomainStartEndE-ValueType
CH 36 145 1.72e-14 SMART
internal_repeat_2 197 249 1.75e-5 PROSPERO
internal_repeat_1 209 418 1.31e-14 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 651 1.31e-14 PROSPERO
internal_repeat_2 600 652 1.75e-5 PROSPERO
IQ 730 752 1.18e1 SMART
IQ 760 782 3.76e-6 SMART
IQ 790 812 3.08e-2 SMART
IQ 820 842 1.72e0 SMART
RasGAP 977 1330 1.74e-57 SMART
Blast:RasGAP 1338 1422 1e-9 BLAST
Pfam:RasGAP_C 1434 1555 2e-36 PFAM
low complexity region 1591 1602 N/A INTRINSIC
low complexity region 1615 1630 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000194440
SMART Domains Protein: ENSMUSP00000142035
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
Blast:RasGAP 1 67 3e-30 BLAST
RasGAP 79 432 1e-59 SMART
Blast:RasGAP 440 524 5e-10 BLAST
Pfam:RasGAP_C 535 660 5.7e-30 PFAM
low complexity region 693 704 N/A INTRINSIC
low complexity region 717 732 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194772
Predicted Effect probably benign
Transcript: ENSMUST00000195465
SMART Domains Protein: ENSMUSP00000142013
Gene: ENSMUSG00000028068

DomainStartEndE-ValueType
CH 36 145 8.5e-17 SMART
internal_repeat_1 209 379 1.33e-7 PROSPERO
low complexity region 419 438 N/A INTRINSIC
internal_repeat_1 446 612 1.33e-7 PROSPERO
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Iqgap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01016:Iqgap3 APN 3 88107560 missense probably damaging 1.00
IGL01062:Iqgap3 APN 3 88110122 missense probably benign 0.00
IGL01517:Iqgap3 APN 3 88109396 missense probably benign 0.09
IGL01530:Iqgap3 APN 3 88112303 critical splice acceptor site probably null
IGL01658:Iqgap3 APN 3 88115971 missense possibly damaging 0.89
IGL02027:Iqgap3 APN 3 88087342 missense possibly damaging 0.67
IGL02352:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02359:Iqgap3 APN 3 88101960 missense probably benign 0.00
IGL02522:Iqgap3 APN 3 88108398 missense possibly damaging 0.94
IGL02717:Iqgap3 APN 3 88098359 missense probably benign 0.01
IGL02971:Iqgap3 APN 3 88090304 missense probably benign 0.30
IGL03079:Iqgap3 APN 3 88113170 missense probably benign
IGL03240:Iqgap3 APN 3 88114974 missense probably benign 0.00
adjutant UTSW 3 88101527 missense possibly damaging 0.51
booster UTSW 3 88113128 missense probably damaging 0.99
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0048:Iqgap3 UTSW 3 88115949 missense probably benign 0.00
R0285:Iqgap3 UTSW 3 88096990 missense probably benign 0.11
R0442:Iqgap3 UTSW 3 88115959 missense probably damaging 0.96
R0490:Iqgap3 UTSW 3 88114056 splice site probably benign
R0569:Iqgap3 UTSW 3 88090725 splice site probably benign
R0747:Iqgap3 UTSW 3 88107503 splice site probably benign
R0843:Iqgap3 UTSW 3 88108431 missense possibly damaging 0.94
R1260:Iqgap3 UTSW 3 88114023 missense probably benign
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1465:Iqgap3 UTSW 3 88087309 missense probably damaging 0.99
R1544:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R1662:Iqgap3 UTSW 3 88098401 missense probably benign 0.33
R1686:Iqgap3 UTSW 3 88108356 splice site probably benign
R1748:Iqgap3 UTSW 3 88113980 missense possibly damaging 0.92
R1836:Iqgap3 UTSW 3 88108368 missense probably damaging 1.00
R1972:Iqgap3 UTSW 3 88083928 splice site probably null
R1973:Iqgap3 UTSW 3 88083928 splice site probably null
R2051:Iqgap3 UTSW 3 88120167 missense probably damaging 1.00
R2314:Iqgap3 UTSW 3 88116031 missense probably benign 0.01
R2857:Iqgap3 UTSW 3 88107596 nonsense probably null
R2859:Iqgap3 UTSW 3 88107596 nonsense probably null
R3435:Iqgap3 UTSW 3 88094604 missense probably benign 0.00
R3522:Iqgap3 UTSW 3 88090782 missense probably null 0.90
R4281:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4283:Iqgap3 UTSW 3 88098860 missense probably benign 0.19
R4397:Iqgap3 UTSW 3 88104358 missense probably damaging 1.00
R4414:Iqgap3 UTSW 3 88096986 missense probably benign
R4660:Iqgap3 UTSW 3 88120176 missense probably damaging 1.00
R4872:Iqgap3 UTSW 3 88113128 missense probably damaging 0.99
R4883:Iqgap3 UTSW 3 88107535 missense probably benign
R4915:Iqgap3 UTSW 3 88101527 missense possibly damaging 0.51
R5050:Iqgap3 UTSW 3 88090186 missense probably damaging 1.00
R5130:Iqgap3 UTSW 3 88108854 missense probably damaging 0.97
R5151:Iqgap3 UTSW 3 88117760 missense possibly damaging 0.58
R5645:Iqgap3 UTSW 3 88117699 missense probably damaging 1.00
R5706:Iqgap3 UTSW 3 88115908 missense probably benign 0.03
R5748:Iqgap3 UTSW 3 88109370 missense probably damaging 1.00
R5880:Iqgap3 UTSW 3 88117202 missense possibly damaging 0.67
R5982:Iqgap3 UTSW 3 88091592 nonsense probably null
R6006:Iqgap3 UTSW 3 88091547 missense probably damaging 0.98
R6026:Iqgap3 UTSW 3 88090171 missense probably damaging 1.00
R6188:Iqgap3 UTSW 3 88098893 missense probably benign 0.00
R6211:Iqgap3 UTSW 3 88091515 missense probably benign
R6291:Iqgap3 UTSW 3 88089730 critical splice donor site probably null
R6344:Iqgap3 UTSW 3 88082094 critical splice donor site probably null
R6854:Iqgap3 UTSW 3 88096951 missense probably damaging 1.00
R6875:Iqgap3 UTSW 3 88112771 frame shift probably null
R6877:Iqgap3 UTSW 3 88112771 frame shift probably null
R6958:Iqgap3 UTSW 3 88113366 missense possibly damaging 0.89
R7008:Iqgap3 UTSW 3 88112771 frame shift probably null
R7050:Iqgap3 UTSW 3 88098913 missense probably damaging 1.00
R7144:Iqgap3 UTSW 3 88116910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGGTAGCGTCTCACCTCTC -3'
(R):5'- TCAGAGGAGCCTTGTCTATGAC -3'

Sequencing Primer
(F):5'- ACCTCTCAGATCCAGGCCTG -3'
(R):5'- TGACAAAACTATGTGCTACTGGG -3'
Posted On2014-10-30