Incidental Mutation 'R2352:Grk4'
ID246189
Institutional Source Beutler Lab
Gene Symbol Grk4
Ensembl Gene ENSMUSG00000052783
Gene NameG protein-coupled receptor kinase 4
SynonymsGprk2l, A830025H08Rik
MMRRC Submission 040334-MU
Accession Numbers

Genbank: NM_019497.2, NM_001080743.1

Is this an essential gene? Probably non essential (E-score: 0.169) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location34660379-34755305 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 34669176 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 40 (M40T)
Ref Sequence ENSEMBL: ENSMUSP00000074223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001112] [ENSMUST00000074651]
Predicted Effect probably benign
Transcript: ENSMUST00000001112
AA Change: M40T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000001112
Gene: ENSMUSG00000052783
AA Change: M40T

DomainStartEndE-ValueType
RGS 51 171 1.61e-31 SMART
S_TKc 186 448 7.78e-85 SMART
S_TK_X 449 528 2.98e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000074651
AA Change: M40T

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000074223
Gene: ENSMUSG00000052783
AA Change: M40T

DomainStartEndE-ValueType
RGS 51 163 1.39e-12 SMART
Predicted Effect unknown
Transcript: ENSMUST00000148588
AA Change: M32T
SMART Domains Protein: ENSMUSP00000122826
Gene: ENSMUSG00000052783
AA Change: M32T

DomainStartEndE-ValueType
PDB:3NYO|B 2 80 2e-27 PDB
SCOP:d1dk8a_ 32 79 3e-5 SMART
Blast:RGS 44 81 3e-18 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the guanine nucleotide-binding protein (G protein)-coupled receptor kinase subfamily of the Ser/Thr protein kinase family. The protein phosphorylates the activated forms of G protein-coupled receptors thus initiating its deactivation. This gene has been linked to both genetic and acquired hypertension. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice heterozygous for a knock-out allele are viable, fertile and overtly normal. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Grk4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00509:Grk4 APN 5 34716290 missense probably damaging 0.99
IGL00574:Grk4 APN 5 34694818 missense probably benign 0.00
IGL02127:Grk4 APN 5 34710186 missense probably benign 0.00
IGL02191:Grk4 APN 5 34755189 missense probably benign 0.27
IGL02227:Grk4 APN 5 34694782 missense probably benign 0.06
IGL03152:Grk4 APN 5 34745357 missense probably damaging 1.00
IGL03214:Grk4 APN 5 34752209 missense probably benign
F5426:Grk4 UTSW 5 34745159 splice site probably benign
R0110:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0469:Grk4 UTSW 5 34716213 missense probably damaging 0.97
R0671:Grk4 UTSW 5 34748267 missense probably benign 0.04
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1466:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1584:Grk4 UTSW 5 34694750 missense probably benign 0.02
R1605:Grk4 UTSW 5 34674557 missense probably damaging 0.98
R1607:Grk4 UTSW 5 34731538 missense probably benign 0.01
R1903:Grk4 UTSW 5 34676187 splice site probably null
R4561:Grk4 UTSW 5 34694813 missense probably benign 0.00
R4580:Grk4 UTSW 5 34660981 missense probably damaging 1.00
R4807:Grk4 UTSW 5 34752208 missense probably benign
R5412:Grk4 UTSW 5 34745268 missense probably benign 0.00
R5905:Grk4 UTSW 5 34711730 missense probably damaging 1.00
R6360:Grk4 UTSW 5 34674537 missense probably damaging 1.00
R6604:Grk4 UTSW 5 34719864 missense probably damaging 1.00
R6865:Grk4 UTSW 5 34731550 missense probably damaging 1.00
R7265:Grk4 UTSW 5 34716264 missense probably damaging 0.96
R7394:Grk4 UTSW 5 34751618 missense probably benign
X0064:Grk4 UTSW 5 34719884 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GCTGTATGACTGACCCTAACATGAAG -3'
(R):5'- ACTGCACTCTAGAGTCTCCATTACAC -3'

Sequencing Primer
(F):5'- GACTGACCCTAACATGAAGTTAATG -3'
(R):5'- TCTAGAGTCTCCATTACACACAAAAG -3'
Posted On2014-10-30