Incidental Mutation 'R2352:Caln1'
ID246191
Institutional Source Beutler Lab
Gene Symbol Caln1
Ensembl Gene ENSMUSG00000060371
Gene Namecalneuron 1
Synonyms9630012C17Rik, Cabp8
MMRRC Submission 040334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location130369455-130847412 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to T at 130506152 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Stop codon at position 70 (E70*)
Ref Sequence ENSEMBL: ENSMUSP00000143823 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000086029] [ENSMUST00000111287] [ENSMUST00000111288] [ENSMUST00000141131] [ENSMUST00000202728]
Predicted Effect probably null
Transcript: ENSMUST00000086029
AA Change: E70*
SMART Domains Protein: ENSMUSP00000083193
Gene: ENSMUSG00000060371
AA Change: E70*

DomainStartEndE-ValueType
EFh 82 110 2.98e-9 SMART
EFh 118 146 2.06e-3 SMART
low complexity region 195 204 N/A INTRINSIC
transmembrane domain 234 256 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111287
AA Change: E28*
SMART Domains Protein: ENSMUSP00000106918
Gene: ENSMUSG00000060371
AA Change: E28*

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000111288
AA Change: E28*
SMART Domains Protein: ENSMUSP00000106919
Gene: ENSMUSG00000060371
AA Change: E28*

DomainStartEndE-ValueType
EFh 40 68 2.98e-9 SMART
EFh 76 104 2.06e-3 SMART
low complexity region 153 162 N/A INTRINSIC
transmembrane domain 192 214 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000141131
AA Change: E28*
SMART Domains Protein: ENSMUSP00000144225
Gene: ENSMUSG00000060371
AA Change: E28*

DomainStartEndE-ValueType
Pfam:EF-hand_1 40 68 1.3e-9 PFAM
Pfam:EF-hand_6 40 69 2.6e-9 PFAM
Pfam:EF-hand_5 41 66 1.1e-6 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000202728
AA Change: E70*
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with high similarity to the calcium-binding proteins of the calmodulin family. The encoded protein contains two EF-hand domains and potential calcium-binding sites. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Caln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Caln1 APN 5 130669551 missense probably damaging 1.00
IGL03152:Caln1 APN 5 130617852 missense probably damaging 0.97
IGL03409:Caln1 APN 5 130617878 missense probably damaging 1.00
ANU22:Caln1 UTSW 5 130669551 missense probably damaging 1.00
R0346:Caln1 UTSW 5 130822921 missense possibly damaging 0.83
R2180:Caln1 UTSW 5 130839408 makesense probably null
R5489:Caln1 UTSW 5 130414832 missense possibly damaging 0.66
R7114:Caln1 UTSW 5 130839283 missense possibly damaging 0.93
R7159:Caln1 UTSW 5 130822997 missense probably benign 0.20
R7355:Caln1 UTSW 5 130414891 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAGCTATGTAACTTCGCCATCTG -3'
(R):5'- TAGCCCTAACTGCCAATGAGAAG -3'

Sequencing Primer
(F):5'- TTCGCCATCTGGAAAATAGAGAC -3'
(R):5'- TGCCAATGAGAAGCCCTCTAGG -3'
Posted On2014-10-30