Incidental Mutation 'R2352:Cd69'
ID246194
Institutional Source Beutler Lab
Gene Symbol Cd69
Ensembl Gene ENSMUSG00000030156
Gene NameCD69 antigen
SynonymsVEA, AIM, 5830438K24Rik
MMRRC Submission 040334-MU
Accession Numbers

Genbank: NM_001033122; MGI: 88343

Is this an essential gene? Probably non essential (E-score: 0.099) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location129267325-129275436 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 129269604 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 114 (W114R)
Ref Sequence ENSEMBL: ENSMUSP00000144734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032259] [ENSMUST00000204411]
Predicted Effect probably damaging
Transcript: ENSMUST00000032259
AA Change: W155R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032259
Gene: ENSMUSG00000030156
AA Change: W155R

DomainStartEndE-ValueType
Blast:CLECT 3 42 3e-8 BLAST
low complexity region 44 61 N/A INTRINSIC
CLECT 85 195 3e-23 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000203727
Predicted Effect probably damaging
Transcript: ENSMUST00000204411
AA Change: W114R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000144734
Gene: ENSMUSG00000030156
AA Change: W114R

DomainStartEndE-ValueType
CLECT 44 154 1.5e-25 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205032
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205190
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the calcium dependent lectin superfamily of type II transmembrane receptors. Expression of the encoded protein is induced upon activation of T lymphocytes, and may play a role in proliferation. Furthermore, the protein may act to transmit signals in natural killer cells and platelets. [provided by RefSeq, Aug 2011]
PHENOTYPE: Homozygous mutation of this gene results in slightly increased pre-B and immature B cell numbers in the bone marrow, and increased IgG2a and IgM response to T cell-dependent and T cell-independent antigens. Mutant mice were less prone to collagen inducedarthritis. [provided by MGI curators]
Allele List at MGI

All alleles(2) : Targeted, knock-out(2)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Cd69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00573:Cd69 APN 6 129268320 missense probably damaging 1.00
IGL02799:Cd69 APN 6 129268260 splice site probably benign
jazzed UTSW 6 129269574 critical splice donor site probably null
surrogate UTSW 6 129269580 missense probably benign 0.00
3-1:Cd69 UTSW 6 129275249 missense probably damaging 0.99
R0119:Cd69 UTSW 6 129270062 missense probably benign 0.01
R0136:Cd69 UTSW 6 129270062 missense probably benign 0.01
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R1185:Cd69 UTSW 6 129270185 missense probably damaging 1.00
R2327:Cd69 UTSW 6 129271388 missense probably damaging 1.00
R3955:Cd69 UTSW 6 129268380 splice site probably null
R4780:Cd69 UTSW 6 129271355 missense probably damaging 1.00
R5400:Cd69 UTSW 6 129269991 missense probably benign 0.01
R5522:Cd69 UTSW 6 129271416 missense probably damaging 0.97
R6594:Cd69 UTSW 6 129269574 critical splice donor site probably null
R6737:Cd69 UTSW 6 129268299 missense probably benign 0.04
R6972:Cd69 UTSW 6 129269580 missense probably benign 0.00
R7240:Cd69 UTSW 6 129270042 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TGAGGAAGAACTGAACCACC -3'
(R):5'- GCTGTATAGTCTCCCAGTGTG -3'

Sequencing Primer
(F):5'- GAGGAAGAACTGAACCACCATGAAC -3'
(R):5'- GATTGCTTAGTTTCAGAGACCAAC -3'
Posted On2014-10-30