Incidental Mutation 'R2352:Vmn1r222'
ID246223
Institutional Source Beutler Lab
Gene Symbol Vmn1r222
Ensembl Gene ENSMUSG00000061022
Gene Namevomeronasal 1 receptor 222
SynonymsV1rh16
MMRRC Submission 040334-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.087) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location23232066-23233119 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 23232513 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Glycine at position 177 (W177G)
Ref Sequence ENSEMBL: ENSMUSP00000076365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077116]
Predicted Effect probably benign
Transcript: ENSMUST00000077116
AA Change: W177G

PolyPhen 2 Score 0.350 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000076365
Gene: ENSMUSG00000061022
AA Change: W177G

DomainStartEndE-ValueType
Pfam:V1R 32 297 3.6e-39 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225143
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dgat1 T C 15: 76,502,313 I474V possibly damaging Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Vmn1r222
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01539:Vmn1r222 APN 13 23232889 missense probably benign 0.45
IGL01960:Vmn1r222 APN 13 23232145 missense probably benign 0.00
IGL02082:Vmn1r222 APN 13 23232329 missense probably damaging 1.00
IGL02616:Vmn1r222 APN 13 23232141 missense possibly damaging 0.73
IGL03155:Vmn1r222 APN 13 23232693 missense probably damaging 1.00
IGL03333:Vmn1r222 APN 13 23233007 missense probably benign 0.18
IGL03391:Vmn1r222 APN 13 23232462 missense possibly damaging 0.94
R0137:Vmn1r222 UTSW 13 23232804 missense probably damaging 1.00
R1584:Vmn1r222 UTSW 13 23232762 missense probably damaging 1.00
R3079:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3080:Vmn1r222 UTSW 13 23232461 missense possibly damaging 0.75
R3963:Vmn1r222 UTSW 13 23232932 missense probably benign 0.01
R4448:Vmn1r222 UTSW 13 23232293 missense probably benign 0.11
R4448:Vmn1r222 UTSW 13 23232660 missense probably damaging 0.99
R4979:Vmn1r222 UTSW 13 23232432 missense possibly damaging 0.78
R5054:Vmn1r222 UTSW 13 23232731 missense probably damaging 0.98
R5182:Vmn1r222 UTSW 13 23232497 missense probably damaging 1.00
R5230:Vmn1r222 UTSW 13 23233002 missense probably benign
R5462:Vmn1r222 UTSW 13 23232875 missense probably benign 0.05
R5611:Vmn1r222 UTSW 13 23232573 missense probably damaging 1.00
R5677:Vmn1r222 UTSW 13 23232780 missense probably damaging 1.00
R6298:Vmn1r222 UTSW 13 23232795 missense probably benign 0.15
R6655:Vmn1r222 UTSW 13 23232716 missense probably damaging 1.00
R6748:Vmn1r222 UTSW 13 23232947 missense probably benign 0.00
R6912:Vmn1r222 UTSW 13 23232204 missense probably benign 0.44
Predicted Primers PCR Primer
(F):5'- GAAGGAGAACACTTTGAGCAGCTC -3'
(R):5'- GTCCAGGCCATCATCATCAG -3'

Sequencing Primer
(F):5'- TCTCAGCTCAGGGGGAGTTC -3'
(R):5'- TCATCAGTCCCAGAGCATCTG -3'
Posted On2014-10-30