Incidental Mutation 'R2352:Dgat1'
ID246231
Institutional Source Beutler Lab
Gene Symbol Dgat1
Ensembl Gene ENSMUSG00000022555
Gene Namediacylglycerol O-acyltransferase 1
SynonymsD15Ertd23e
MMRRC Submission 040334-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.393) question?
Stock #R2352 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76502015-76511953 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 76502313 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 474 (I474V)
Ref Sequence ENSEMBL: ENSMUSP00000023214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023214] [ENSMUST00000072838] [ENSMUST00000226860] [ENSMUST00000226872] [ENSMUST00000227478] [ENSMUST00000228371] [ENSMUST00000228757] [ENSMUST00000228868] [ENSMUST00000229363]
Predicted Effect possibly damaging
Transcript: ENSMUST00000023214
AA Change: I474V

PolyPhen 2 Score 0.658 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000023214
Gene: ENSMUSG00000022555
AA Change: I474V

DomainStartEndE-ValueType
low complexity region 2 26 N/A INTRINSIC
low complexity region 41 57 N/A INTRINSIC
transmembrane domain 137 159 N/A INTRINSIC
Pfam:MBOAT 162 485 8.4e-64 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072838
SMART Domains Protein: ENSMUSP00000072617
Gene: ENSMUSG00000022556

DomainStartEndE-ValueType
HSF 14 118 2.27e-66 SMART
Pfam:Vert_HS_TF 247 414 6e-65 PFAM
Pfam:Vert_HS_TF 412 503 1.9e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159908
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160293
SMART Domains Protein: ENSMUSP00000123779
Gene: ENSMUSG00000022555

DomainStartEndE-ValueType
Pfam:MBOAT 41 201 4.3e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160294
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161499
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162813
Predicted Effect probably benign
Transcript: ENSMUST00000226238
Predicted Effect probably benign
Transcript: ENSMUST00000226860
Predicted Effect probably benign
Transcript: ENSMUST00000226872
Predicted Effect probably benign
Transcript: ENSMUST00000227478
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227921
Predicted Effect probably benign
Transcript: ENSMUST00000228371
Predicted Effect probably benign
Transcript: ENSMUST00000228688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228720
Predicted Effect probably benign
Transcript: ENSMUST00000228757
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228781
Predicted Effect probably benign
Transcript: ENSMUST00000228868
Predicted Effect probably benign
Transcript: ENSMUST00000229363
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229569
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230069
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230505
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231035
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an multipass transmembrane protein that functions as a key metabolic enzyme. The encoded protein catalyzes the conversion of diacylglycerol and fatty acyl CoA to triacylglycerol. This enzyme can also transfer acyl CoA to retinol. Activity of this protein may be associated with obesity and other metabolic diseases. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous inactivation of this gene leads to decreased percent body fat, resistance to diet-induced obesity, altered energy, glucose and triglyceride metabolism, alopecia, hair cycle and skin defects, and a lactation failure associated with impaired mammary gland growth during pregnancy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210407C18Rik G A 11: 58,612,108 Q72* probably null Het
2210407C18Rik A T 11: 58,612,850 L10H probably damaging Het
Ankrd28 C T 14: 31,710,947 V548I probably benign Het
Aspm T C 1: 139,457,562 S315P probably benign Het
Caln1 G T 5: 130,506,152 E70* probably null Het
Cd69 A T 6: 129,269,604 W114R probably damaging Het
Cnbd2 T C 2: 156,335,355 Y90H probably damaging Het
Crebrf C T 17: 26,742,346 S147F probably damaging Het
Cts7 A T 13: 61,352,772 C320* probably null Het
Dmxl2 T A 9: 54,393,862 I2322F probably damaging Het
Dnah11 A T 12: 117,928,330 F3703I probably damaging Het
Foxb2 A G 19: 16,873,069 L191P unknown Het
Gli3 A T 13: 15,662,392 E453D probably benign Het
Gnl3 C T 14: 31,016,826 probably null Het
Golgb1 A T 16: 36,898,559 T276S probably damaging Het
Grk4 T C 5: 34,669,176 M40T probably benign Het
Hoxb1 A G 11: 96,366,377 N184S possibly damaging Het
Insr G T 8: 3,192,593 T42N probably damaging Het
Iqgap3 A G 3: 88,104,508 K836E possibly damaging Het
Kremen1 CGGG CGGGGGG 11: 5,201,791 probably benign Het
Leng9 T A 7: 4,149,410 E89V probably damaging Het
Lhcgr C T 17: 88,742,299 V600I possibly damaging Het
Lima1 T C 15: 99,794,515 N183S probably benign Het
Lmtk2 A G 5: 144,173,911 D483G probably benign Het
Lpcat2b T G 5: 107,433,441 L212R probably damaging Het
Lrrc61 A T 6: 48,568,872 I210F probably benign Het
Med12l C T 3: 59,240,692 L977F probably damaging Het
Mical1 A T 10: 41,482,233 D414V probably benign Het
Mmp14 C T 14: 54,440,545 A541V probably benign Het
Mtmr10 A G 7: 64,297,580 D81G possibly damaging Het
Myh1 G A 11: 67,220,537 V1601M probably benign Het
Myo16 G A 8: 10,594,905 D1746N possibly damaging Het
Neb T C 2: 52,287,336 Y1331C probably damaging Het
Otop2 T C 11: 115,329,101 S256P probably damaging Het
Prl8a1 A G 13: 27,575,589 L155P probably damaging Het
Rrp1b A T 17: 32,059,328 M658L possibly damaging Het
Sema4b C A 7: 80,220,879 A525D probably damaging Het
Slc13a5 T A 11: 72,252,321 I369F probably benign Het
Slc22a18 T C 7: 143,497,415 S344P probably benign Het
Slc25a4 A C 8: 46,209,175 S149A probably benign Het
Smc2 A T 4: 52,460,266 E547D probably benign Het
Stx8 A G 11: 67,973,251 T46A probably benign Het
Tacr3 T C 3: 134,854,870 V190A probably benign Het
Tdrkh A T 3: 94,429,160 K468M possibly damaging Het
Tmem145 T C 7: 25,306,173 S4P probably benign Het
Tmem74 A G 15: 43,867,110 I179T probably damaging Het
Vmn1r222 A C 13: 23,232,513 W177G probably benign Het
Zfp426 T C 9: 20,470,105 I529V probably benign Het
Zfp462 A G 4: 55,008,313 Y93C probably null Het
Zfyve26 G A 12: 79,284,116 T443I probably damaging Het
Zkscan16 A C 4: 58,951,869 R181S possibly damaging Het
Other mutations in Dgat1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01874:Dgat1 APN 15 76503041 missense probably damaging 1.00
IGL02713:Dgat1 APN 15 76503534 missense probably damaging 1.00
R0510:Dgat1 UTSW 15 76511567 missense possibly damaging 0.85
R0894:Dgat1 UTSW 15 76502999 missense possibly damaging 0.55
R1525:Dgat1 UTSW 15 76511586 missense probably benign
R1682:Dgat1 UTSW 15 76503019 missense probably benign 0.03
R1740:Dgat1 UTSW 15 76502729 missense probably damaging 1.00
R1817:Dgat1 UTSW 15 76502503 missense probably damaging 1.00
R3012:Dgat1 UTSW 15 76503393 missense possibly damaging 0.90
R3154:Dgat1 UTSW 15 76502521 missense probably benign 0.27
R4059:Dgat1 UTSW 15 76504171 missense possibly damaging 0.79
R4593:Dgat1 UTSW 15 76504689 missense probably damaging 1.00
R5503:Dgat1 UTSW 15 76502194 unclassified probably benign
R5818:Dgat1 UTSW 15 76502207 unclassified probably benign
R5984:Dgat1 UTSW 15 76502258 missense probably damaging 1.00
R6228:Dgat1 UTSW 15 76503293 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- GCTGAGATTCAAATGCCATCC -3'
(R):5'- GAGGAGCTCTGCGAAGTTTG -3'

Sequencing Primer
(F):5'- CATCCCCAAGAGCAGGAGTAG -3'
(R):5'- GAAGTTTGTCCCGCTCAGC -3'
Posted On2014-10-30