Incidental Mutation 'R2365:Kera'
ID246301
Institutional Source Beutler Lab
Gene Symbol Kera
Ensembl Gene ENSMUSG00000019932
Gene Namekeratocan
SynonymsSLRR2B, CNA2
MMRRC Submission 040346-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2365 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location97606879-97613692 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97608943 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 55 (T55A)
Ref Sequence ENSEMBL: ENSMUSP00000100923 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105286]
Predicted Effect probably benign
Transcript: ENSMUST00000105286
AA Change: T55A

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000100923
Gene: ENSMUSG00000019932
AA Change: T55A

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
LRRNT 42 76 1.9e-14 SMART
LRR 71 90 2.5e-1 SMART
LRR 121 140 2.1e-1 SMART
LRR 142 161 1.5e0 SMART
LRR 166 191 3.4e-2 SMART
LRR 192 215 2.8e-2 SMART
LRR 213 232 9.2e-1 SMART
Blast:LRR 237 261 4e-8 BLAST
LRR 262 281 6.3e-2 SMART
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 94.9%
Validation Efficiency 94% (34/36)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a keratan sulfate proteoglycan that is involved in corneal transparency. Defects in this gene are a cause of autosomal recessive cornea plana 2 (CNA2).[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for disruptions in this gene have a thinner than normal corneal stroma with thicker collagen fibers which were less regularly packed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp13a5 T A 16: 29,251,256 K959N probably benign Het
C4b G A 17: 34,736,058 probably benign Het
Cdhr2 T G 13: 54,718,088 S268R probably benign Het
Erc1 A G 6: 119,575,695 L1094P probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Fat4 A G 3: 38,980,419 H2740R probably benign Het
Galnt13 A G 2: 54,854,697 Y136C possibly damaging Het
Gipc2 A G 3: 152,128,194 I150T possibly damaging Het
Gkn3 C T 6: 87,383,525 A163T probably damaging Het
Gm21957 T C 7: 125,219,457 noncoding transcript Het
Gm5591 T A 7: 38,519,401 R683W probably damaging Het
Gm826 A G 2: 160,327,210 S60P unknown Het
Hsd17b7 T C 1: 169,964,440 D133G probably damaging Het
Mff T C 1: 82,735,471 V129A possibly damaging Het
Myo7b A G 18: 32,014,331 L53P probably damaging Het
Neo1 A G 9: 58,956,003 V427A probably benign Het
Olfr1328 C T 4: 118,934,033 E272K probably benign Het
Olfr596 A T 7: 103,310,173 I151L probably benign Het
Pfkfb3 C T 2: 11,493,902 probably null Het
Pom121l2 A G 13: 21,983,784 T742A probably benign Het
Pon1 A G 6: 5,171,746 S302P probably damaging Het
Rhox3f G T X: 37,582,019 E140* probably null Het
Sall3 G C 18: 80,971,792 P974A probably benign Het
Slc1a2 T A 2: 102,748,453 probably null Het
Slc22a6 A G 19: 8,619,397 T180A probably benign Het
Slc40a1 T C 1: 45,924,713 probably null Het
Slc6a5 T C 7: 49,946,536 S585P possibly damaging Het
Tbpl1 A G 10: 22,705,886 V164A possibly damaging Het
Tmem98 A T 11: 80,815,685 I95F probably damaging Het
Ush2a C A 1: 188,378,991 P571T possibly damaging Het
Vars A G 17: 35,015,452 N1125D probably benign Het
Vps13d T C 4: 145,087,324 probably benign Het
Zbtb18 A T 1: 177,448,157 E361V probably benign Het
Zc3hav1 A G 6: 38,340,233 F144S probably damaging Het
Other mutations in Kera
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01670:Kera APN 10 97609077 missense possibly damaging 0.79
R1309:Kera UTSW 10 97609426 missense possibly damaging 0.82
R1830:Kera UTSW 10 97609147 missense probably benign 0.29
R1895:Kera UTSW 10 97609147 missense probably benign 0.29
R1946:Kera UTSW 10 97609147 missense probably benign 0.29
R3957:Kera UTSW 10 97612845 missense probably benign
R4198:Kera UTSW 10 97612973 makesense probably null
R4624:Kera UTSW 10 97609631 missense probably benign 0.00
R4625:Kera UTSW 10 97609631 missense probably benign 0.00
R4628:Kera UTSW 10 97609631 missense probably benign 0.00
R4629:Kera UTSW 10 97609631 missense probably benign 0.00
R4640:Kera UTSW 10 97612887 missense probably damaging 1.00
R6496:Kera UTSW 10 97612810 missense probably benign
R6767:Kera UTSW 10 97609172 missense possibly damaging 0.92
R6999:Kera UTSW 10 97608952 missense probably damaging 1.00
R7017:Kera UTSW 10 97609077 missense possibly damaging 0.79
R7117:Kera UTSW 10 97612852 missense probably benign
Predicted Primers PCR Primer
(F):5'- CACAGGTGCTGTAATGGCAAC -3'
(R):5'- GCTCATTGTCTTCAAGAAACAGG -3'

Sequencing Primer
(F):5'- ACCCCAAACTGTTTAATACTCTGGG -3'
(R):5'- AAGAAGTTTCTTTAGCTGGCTCAG -3'
Posted On2014-10-30