Incidental Mutation 'R2366:Pik3ca'
ID 246322
Institutional Source Beutler Lab
Gene Symbol Pik3ca
Ensembl Gene ENSMUSG00000027665
Gene Name phosphatidylinositol-4,5-bisphosphate 3-kinase catalytic subunit alpha
Synonyms 6330412C24Rik, caPI3K, p110alpha
MMRRC Submission 040347-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2366 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 32451203-32520256 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to A at 32516943 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Tryptophan to Stop codon at position 1057 (W1057*)
Ref Sequence ENSEMBL: ENSMUSP00000103878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029201] [ENSMUST00000108242] [ENSMUST00000108243]
AlphaFold P42337
Predicted Effect probably null
Transcript: ENSMUST00000029201
AA Change: W1057*
SMART Domains Protein: ENSMUSP00000029201
Gene: ENSMUSG00000027665
AA Change: W1057*

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108242
AA Change: W935*
SMART Domains Protein: ENSMUSP00000103877
Gene: ENSMUSG00000027665
AA Change: W935*

DomainStartEndE-ValueType
PI3K_rbd 51 170 5e-47 SMART
PI3K_C2 200 303 2.39e-35 SMART
C2 211 319 3.95e-1 SMART
PI3Ka 396 582 8.35e-99 SMART
Blast:PI3Kc 611 644 1e-11 BLAST
PI3Kc 676 943 8.82e-130 SMART
Predicted Effect probably null
Transcript: ENSMUST00000108243
AA Change: W1057*
SMART Domains Protein: ENSMUSP00000103878
Gene: ENSMUSG00000027665
AA Change: W1057*

DomainStartEndE-ValueType
PI3K_p85B 31 108 3.03e-46 SMART
PI3K_rbd 173 292 5e-47 SMART
PI3K_C2 322 425 2.39e-35 SMART
C2 333 441 3.95e-1 SMART
PI3Ka 518 704 8.35e-99 SMART
Blast:PI3Kc 733 766 1e-11 BLAST
PI3Kc 798 1065 8.82e-130 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195230
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphatidylinositol 3-kinase is composed of an 85 kDa regulatory subunit and a 110 kDa catalytic subunit. The protein encoded by this gene represents the catalytic subunit, which uses ATP to phosphorylate PtdIns, PtdIns4P and PtdIns(4,5)P2. This gene has been found to be oncogenic and has been implicated in cervical cancers. A pseudogene of this gene has been defined on chromosome 22. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous null or knock-in mutations of this gene lead to embryonic death associated with growth retardation, vascular defects and hemorrhage. Surviving mice homozygous for a knock-in allele show impaired lymphangiogenesis, ascites, reduced weight, and resistance to Ras-driven skin tumorigenesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A630091E08Rik G A 7: 98,192,949 (GRCm39) noncoding transcript Het
Adamts5 C T 16: 85,659,646 (GRCm39) G882D probably damaging Het
Arl6ip6 T C 2: 53,082,379 (GRCm39) V82A probably benign Het
Brd10 A T 19: 29,731,035 (GRCm39) I726N probably damaging Het
Cd38 T G 5: 44,060,932 (GRCm39) probably benign Het
Cep250 G A 2: 155,834,552 (GRCm39) R2159K probably damaging Het
Col6a6 C A 9: 105,632,893 (GRCm39) G1457V probably damaging Het
Cyp2c69 T C 19: 39,866,038 (GRCm39) N185S probably benign Het
Cyp2d12 T A 15: 82,439,355 (GRCm39) L3Q probably damaging Het
Dnajc28 G A 16: 91,413,755 (GRCm39) T187M probably damaging Het
Drc1 A G 5: 30,523,894 (GRCm39) *754W probably null Het
Erbin G A 13: 103,981,417 (GRCm39) H503Y probably damaging Het
F3 G A 3: 121,526,194 (GRCm39) probably null Het
Gm10033 A T 8: 69,826,232 (GRCm39) M112K unknown Het
Gps1 A C 11: 120,678,945 (GRCm39) I404L probably damaging Het
Hc T C 2: 34,903,648 (GRCm39) N1002S probably benign Het
Impg2 T C 16: 56,080,236 (GRCm39) I571T probably benign Het
Knop1 C A 7: 118,451,751 (GRCm39) V323F possibly damaging Het
Kntc1 C T 5: 123,919,255 (GRCm39) L845F probably damaging Het
Lsm5 T C 6: 56,680,003 (GRCm39) D53G probably damaging Het
Lzts1 T C 8: 69,593,257 (GRCm39) probably null Het
Matr3 A T 18: 35,721,448 (GRCm39) N473I probably damaging Het
Med1 A G 11: 98,052,008 (GRCm39) V452A probably damaging Het
Napsa T A 7: 44,231,909 (GRCm39) D44E probably damaging Het
Nbeal1 T C 1: 60,290,511 (GRCm39) F1036S probably damaging Het
Ncapg2 G A 12: 116,384,349 (GRCm39) W270* probably null Het
Nherf1 G A 11: 115,054,454 (GRCm39) V35M probably benign Het
Or5af1 C A 11: 58,722,039 (GRCm39) Q20K probably benign Het
Pkd1l2 A T 8: 117,770,056 (GRCm39) D1133E probably benign Het
Pramel39-ps T C 5: 94,450,972 (GRCm39) K385E probably benign Het
Prox1 T A 1: 189,894,079 (GRCm39) E122V probably damaging Het
Rest C A 5: 77,416,034 (GRCm39) H83N probably benign Het
Rundc3a A G 11: 102,288,491 (GRCm39) I68V probably damaging Het
Stx6 A T 1: 155,077,706 (GRCm39) I238L probably benign Het
Ttn A T 2: 76,641,587 (GRCm39) L5176Q possibly damaging Het
Ubqln3 C A 7: 103,790,256 (GRCm39) Q611H probably damaging Het
Usp6nl T A 2: 6,445,770 (GRCm39) H559Q probably benign Het
Vipr1 T G 9: 121,494,250 (GRCm39) V277G probably benign Het
Zfp101 A T 17: 33,599,972 (GRCm39) C595S probably benign Het
Zfp398 C T 6: 47,840,143 (GRCm39) T124I possibly damaging Het
Other mutations in Pik3ca
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01284:Pik3ca APN 3 32,516,733 (GRCm39) missense probably damaging 1.00
IGL01894:Pik3ca APN 3 32,504,175 (GRCm39) missense possibly damaging 0.91
IGL03118:Pik3ca APN 3 32,514,084 (GRCm39) missense probably damaging 1.00
IGL03184:Pik3ca APN 3 32,494,035 (GRCm39) missense probably benign 0.27
IGL03401:Pik3ca APN 3 32,491,963 (GRCm39) splice site probably null
Interrupted UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
Lilfella UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
Peninsular UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
Severed UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R0084:Pik3ca UTSW 3 32,516,937 (GRCm39) missense possibly damaging 0.78
R0116:Pik3ca UTSW 3 32,514,094 (GRCm39) missense probably damaging 1.00
R0278:Pik3ca UTSW 3 32,493,902 (GRCm39) missense possibly damaging 0.60
R0513:Pik3ca UTSW 3 32,515,660 (GRCm39) missense probably damaging 1.00
R0543:Pik3ca UTSW 3 32,504,410 (GRCm39) critical splice acceptor site probably null
R0622:Pik3ca UTSW 3 32,490,701 (GRCm39) missense probably damaging 1.00
R0630:Pik3ca UTSW 3 32,504,176 (GRCm39) missense possibly damaging 0.91
R1193:Pik3ca UTSW 3 32,510,242 (GRCm39) missense probably damaging 0.99
R1292:Pik3ca UTSW 3 32,508,569 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1464:Pik3ca UTSW 3 32,515,990 (GRCm39) missense probably damaging 1.00
R1869:Pik3ca UTSW 3 32,504,499 (GRCm39) missense probably damaging 0.99
R1962:Pik3ca UTSW 3 32,498,016 (GRCm39) missense probably benign 0.27
R1969:Pik3ca UTSW 3 32,505,903 (GRCm39) critical splice acceptor site probably null
R2006:Pik3ca UTSW 3 32,504,206 (GRCm39) missense probably damaging 1.00
R2264:Pik3ca UTSW 3 32,492,076 (GRCm39) missense possibly damaging 0.65
R2680:Pik3ca UTSW 3 32,498,034 (GRCm39) missense probably benign 0.00
R2680:Pik3ca UTSW 3 32,490,697 (GRCm39) nonsense probably null
R3001:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R3002:Pik3ca UTSW 3 32,516,946 (GRCm39) missense probably damaging 1.00
R4303:Pik3ca UTSW 3 32,494,084 (GRCm39) nonsense probably null
R4416:Pik3ca UTSW 3 32,515,679 (GRCm39) missense probably damaging 0.99
R4758:Pik3ca UTSW 3 32,492,127 (GRCm39) missense probably benign 0.20
R4822:Pik3ca UTSW 3 32,492,131 (GRCm39) missense probably benign 0.04
R4856:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R4886:Pik3ca UTSW 3 32,491,312 (GRCm39) missense probably damaging 1.00
R5297:Pik3ca UTSW 3 32,504,202 (GRCm39) missense probably damaging 1.00
R5636:Pik3ca UTSW 3 32,515,709 (GRCm39) missense probably damaging 1.00
R5663:Pik3ca UTSW 3 32,516,928 (GRCm39) missense probably damaging 1.00
R6249:Pik3ca UTSW 3 32,515,712 (GRCm39) missense probably damaging 1.00
R6264:Pik3ca UTSW 3 32,494,863 (GRCm39) critical splice donor site probably null
R6347:Pik3ca UTSW 3 32,516,970 (GRCm39) missense probably benign 0.38
R6538:Pik3ca UTSW 3 32,493,853 (GRCm39) missense probably damaging 1.00
R7020:Pik3ca UTSW 3 32,490,428 (GRCm39) missense probably damaging 0.97
R7720:Pik3ca UTSW 3 32,490,367 (GRCm39) missense probably damaging 1.00
R7864:Pik3ca UTSW 3 32,497,762 (GRCm39) nonsense probably null
R8218:Pik3ca UTSW 3 32,491,996 (GRCm39) missense possibly damaging 0.74
R8478:Pik3ca UTSW 3 32,505,997 (GRCm39) missense probably benign
R9100:Pik3ca UTSW 3 32,514,168 (GRCm39) missense probably damaging 1.00
R9169:Pik3ca UTSW 3 32,503,755 (GRCm39) critical splice donor site probably null
R9255:Pik3ca UTSW 3 32,496,981 (GRCm39) critical splice donor site probably null
R9267:Pik3ca UTSW 3 32,492,211 (GRCm39) missense probably damaging 1.00
R9278:Pik3ca UTSW 3 32,508,587 (GRCm39) missense probably damaging 1.00
R9501:Pik3ca UTSW 3 32,504,062 (GRCm39) missense probably damaging 1.00
R9555:Pik3ca UTSW 3 32,505,916 (GRCm39) missense probably damaging 1.00
Z1177:Pik3ca UTSW 3 32,492,116 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCATGCCAATCTCTTCATCAAC -3'
(R):5'- TATCAAACCCTGCTTGCGTG -3'

Sequencing Primer
(F):5'- GACTCTAGCCTTGGACAA -3'
(R):5'- AAACCCTGCTTGCGTGTACAG -3'
Posted On 2014-10-30