Incidental Mutation 'R2366:Napsa'
ID246332
Institutional Source Beutler Lab
Gene Symbol Napsa
Ensembl Gene ENSMUSG00000002204
Gene Namenapsin A aspartic peptidase
SynonymsKdap, NAP1, napsin, pronapsin
MMRRC Submission 040347-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.090) question?
Stock #R2366 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location44572380-44586862 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 44582485 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 44 (D44E)
Ref Sequence ENSEMBL: ENSMUSP00000146791 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002274] [ENSMUST00000208514]
Predicted Effect probably damaging
Transcript: ENSMUST00000002274
AA Change: D199E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002274
Gene: ENSMUSG00000002204
AA Change: D199E

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Asp 72 396 6.6e-109 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153124
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207543
Predicted Effect probably damaging
Transcript: ENSMUST00000208514
AA Change: D44E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209101
Meta Mutation Damage Score 0.204 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the peptidase A1 family of aspartic proteases. The encoded preproprotein is proteolytically processed to generate an activation peptide and the mature protease. The activation peptides of aspartic proteinases function as inhibitors of the protease active site. These peptide segments, or pro-parts, are deemed important for correct folding, targeting, and control of the activation of aspartic proteinase zymogens. The encoded protease may play a role in the proteolytic processing of pulmonary surfactant protein B in the lung and may function in protein catabolism in the renal proximal tubules. This gene has been described as a marker for lung adenocarcinoma and renal cell carcinoma. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A T 19: 29,753,635 I726N probably damaging Het
A430089I19Rik T C 5: 94,303,113 K385E probably benign Het
A630091E08Rik G A 7: 98,543,742 noncoding transcript Het
Adamts5 C T 16: 85,862,758 G882D probably damaging Het
Arl6ip6 T C 2: 53,192,367 V82A probably benign Het
Cd38 T G 5: 43,903,590 probably benign Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Col6a6 C A 9: 105,755,694 G1457V probably damaging Het
Cyp2c69 T C 19: 39,877,594 N185S probably benign Het
Cyp2d12 T A 15: 82,555,154 L3Q probably damaging Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Drc1 A G 5: 30,366,550 *754W probably null Het
Erbin G A 13: 103,844,909 H503Y probably damaging Het
F3 G A 3: 121,732,545 probably null Het
Gps1 A C 11: 120,788,119 I404L probably damaging Het
Hc T C 2: 35,013,636 N1002S probably benign Het
Impg2 T C 16: 56,259,873 I571T probably benign Het
Knop1 C A 7: 118,852,528 V323F possibly damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Lsm5 T C 6: 56,703,018 D53G probably damaging Het
Lzts1 T C 8: 69,140,605 probably null Het
Matr3 A T 18: 35,588,395 N473I probably damaging Het
Med1 A G 11: 98,161,182 V452A probably damaging Het
Nbeal1 T C 1: 60,251,352 F1036S probably damaging Het
Ncapg2 G A 12: 116,420,729 W270* probably null Het
Olfr312 C A 11: 58,831,213 Q20K probably benign Het
Pik3ca G A 3: 32,462,794 W1057* probably null Het
Pkd1l2 A T 8: 117,043,317 D1133E probably benign Het
Prox1 T A 1: 190,161,882 E122V probably damaging Het
Rest C A 5: 77,268,187 H83N probably benign Het
RP23-114B10.6 A T 8: 69,373,580 M112K unknown Het
Rundc3a A G 11: 102,397,665 I68V probably damaging Het
Slc9a3r1 G A 11: 115,163,628 V35M probably benign Het
Stx6 A T 1: 155,201,960 I238L probably benign Het
Ttn A T 2: 76,811,243 L5176Q possibly damaging Het
Ubqln3 C A 7: 104,141,049 Q611H probably damaging Het
Usp6nl T A 2: 6,440,959 H559Q probably benign Het
Vipr1 T G 9: 121,665,184 V277G probably benign Het
Zfp101 A T 17: 33,380,998 C595S probably benign Het
Zfp398 C T 6: 47,863,209 T124I possibly damaging Het
Other mutations in Napsa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00708:Napsa APN 7 44581421 missense probably benign 0.00
IGL01380:Napsa APN 7 44586674 missense probably damaging 0.99
IGL01521:Napsa APN 7 44586637 missense probably damaging 1.00
IGL01630:Napsa APN 7 44586665 missense probably damaging 1.00
IGL01862:Napsa APN 7 44582493 missense probably damaging 0.99
IGL01935:Napsa APN 7 44586622 missense probably benign 0.01
IGL02421:Napsa APN 7 44585055 missense probably damaging 1.00
IGL02831:Napsa APN 7 44586760 missense probably benign
IGL03008:Napsa APN 7 44585796 missense possibly damaging 0.77
PIT4131001:Napsa UTSW 7 44581451 missense probably damaging 1.00
R0422:Napsa UTSW 7 44585106 missense probably damaging 1.00
R1542:Napsa UTSW 7 44581689 missense probably damaging 1.00
R1564:Napsa UTSW 7 44586649 missense probably damaging 1.00
R1903:Napsa UTSW 7 44581736 missense probably damaging 1.00
R1964:Napsa UTSW 7 44581685 missense probably benign 0.01
R3713:Napsa UTSW 7 44581428 missense probably damaging 1.00
R5441:Napsa UTSW 7 44581393 unclassified probably benign
R5512:Napsa UTSW 7 44572616 start codon destroyed probably null 0.01
R5682:Napsa UTSW 7 44585344 missense possibly damaging 0.92
R6290:Napsa UTSW 7 44581337 missense probably benign 0.00
R7046:Napsa UTSW 7 44585085 missense probably damaging 1.00
R7134:Napsa UTSW 7 44585735 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGCAGGACCTCAGCCATAAG -3'
(R):5'- GGTTCCCCAGAGTAAACTGTG -3'

Sequencing Primer
(F):5'- CCTCAGCCATAAGAAGAGTAATGTG -3'
(R):5'- ACTGTGGTAGAAGGGTGCC -3'
Posted On2014-10-30