Incidental Mutation 'R2367:Cyp2c69'
ID246394
Institutional Source Beutler Lab
Gene Symbol Cyp2c69
Ensembl Gene ENSMUSG00000092008
Gene Namecytochrome P450, family 2, subfamily c, polypeptide 69
SynonymsAI098658
MMRRC Submission 040348-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.058) question?
Stock #R2367 (G1)
Quality Score186
Status Not validated
Chromosome19
Chromosomal Location39842660-39886769 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39877594 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 185 (N185S)
Ref Sequence ENSEMBL: ENSMUSP00000132832 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168838]
Predicted Effect probably benign
Transcript: ENSMUST00000168838
AA Change: N185S

PolyPhen 2 Score 0.120 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000132832
Gene: ENSMUSG00000092008
AA Change: N185S

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Pfam:p450 30 487 7e-152 PFAM
Meta Mutation Damage Score 0.1512 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adipoq T C 16: 23,155,319 V32A probably benign Het
Ceacam3 T C 7: 17,151,888 probably null Het
Cep250 G A 2: 155,992,632 R2159K probably damaging Het
Cfap46 C A 7: 139,653,498 V296F probably damaging Het
Ctdspl2 T C 2: 121,987,018 V182A probably benign Het
Daxx C T 17: 33,911,847 R279W probably benign Het
Dnajc28 G A 16: 91,616,867 T187M probably damaging Het
Fat3 G A 9: 15,998,271 S2145F probably damaging Het
Galnt13 A T 2: 55,112,944 M552L probably benign Het
Gstt2 C T 10: 75,832,690 G108S probably benign Het
Heatr1 T A 13: 12,433,724 L422Q probably damaging Het
Kntc1 C T 5: 123,781,192 L845F probably damaging Het
Krtap26-1 C A 16: 88,647,325 R136L probably benign Het
Mrgprb5 C T 7: 48,168,599 W129* probably null Het
Ms4a3 G A 19: 11,629,744 P186S probably benign Het
Myo15 T A 11: 60,517,238 M3184K probably damaging Het
Olfr1044 T C 2: 86,171,637 Y60C probably damaging Het
Olig2 G A 16: 91,226,566 R56Q possibly damaging Het
Pgap3 C T 11: 98,391,159 probably null Het
Phgdh C G 3: 98,314,296 G440A probably benign Het
Scn1a T C 2: 66,327,679 Q450R probably damaging Het
Sema4d CGGGG CGGGGGGG 13: 51,703,140 probably benign Het
Sik1 C T 17: 31,846,297 V776I possibly damaging Het
Slc25a39 T A 11: 102,403,651 T316S possibly damaging Het
Slc38a10 C T 11: 120,110,261 E578K probably benign Het
Slc44a5 T A 3: 154,247,809 I276K possibly damaging Het
Smarcc2 A G 10: 128,482,167 T610A possibly damaging Het
Spag9 G A 11: 94,116,757 S1090N probably damaging Het
Tpr T C 1: 150,433,728 V277A probably damaging Het
Traf3ip1 T G 1: 91,507,520 S314A possibly damaging Het
Tril T A 6: 53,819,166 D357V probably damaging Het
Tube1 T C 10: 39,144,919 L267P probably damaging Het
Vmn1r11 A G 6: 57,137,431 I27V probably benign Het
Other mutations in Cyp2c69
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01873:Cyp2c69 APN 19 39881249 splice site probably benign
IGL02127:Cyp2c69 APN 19 39851057 missense probably damaging 0.99
IGL02945:Cyp2c69 APN 19 39886647 missense possibly damaging 0.81
IGL03067:Cyp2c69 APN 19 39881093 missense probably benign 0.29
IGL03069:Cyp2c69 APN 19 39881093 missense probably benign 0.29
R0545:Cyp2c69 UTSW 19 39886661 missense probably damaging 1.00
R1276:Cyp2c69 UTSW 19 39876224 missense possibly damaging 0.47
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1468:Cyp2c69 UTSW 19 39849395 missense probably damaging 1.00
R1534:Cyp2c69 UTSW 19 39851149 missense probably benign
R1549:Cyp2c69 UTSW 19 39842986 missense probably benign 0.11
R1703:Cyp2c69 UTSW 19 39876366 missense probably benign 0.10
R1752:Cyp2c69 UTSW 19 39881153 missense probably damaging 1.00
R1769:Cyp2c69 UTSW 19 39876371 missense probably benign 0.00
R1843:Cyp2c69 UTSW 19 39877528 missense probably benign 0.27
R1938:Cyp2c69 UTSW 19 39849366 missense probably damaging 0.97
R2100:Cyp2c69 UTSW 19 39886686 missense probably benign 0.11
R2366:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R2440:Cyp2c69 UTSW 19 39876294 missense probably benign 0.17
R2931:Cyp2c69 UTSW 19 39849483 missense probably damaging 1.00
R3709:Cyp2c69 UTSW 19 39851223 splice site probably benign
R3793:Cyp2c69 UTSW 19 39881156 missense probably benign 0.44
R3898:Cyp2c69 UTSW 19 39876390 missense probably benign 0.00
R4579:Cyp2c69 UTSW 19 39881186 missense possibly damaging 0.89
R4707:Cyp2c69 UTSW 19 39849408 missense probably benign 0.39
R4778:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4779:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4780:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4838:Cyp2c69 UTSW 19 39877594 missense probably benign 0.12
R4877:Cyp2c69 UTSW 19 39877612 missense probably damaging 1.00
R5488:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R5489:Cyp2c69 UTSW 19 39851159 missense probably null 0.94
R6083:Cyp2c69 UTSW 19 39849456 missense probably damaging 1.00
R6278:Cyp2c69 UTSW 19 39843063 nonsense probably null
R6415:Cyp2c69 UTSW 19 39842921 missense probably benign 0.44
R6732:Cyp2c69 UTSW 19 39881499 missense probably benign
R6858:Cyp2c69 UTSW 19 39877565 missense probably benign 0.19
R7023:Cyp2c69 UTSW 19 39877542 missense probably benign 0.43
R7227:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7228:Cyp2c69 UTSW 19 39881166 missense possibly damaging 0.77
R7260:Cyp2c69 UTSW 19 39842900 missense probably benign 0.00
R7262:Cyp2c69 UTSW 19 39886732 start gained probably benign
R7479:Cyp2c69 UTSW 19 39881557 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GTACTTGTCTGACATGTCTCTATTG -3'
(R):5'- AAGATCACCATTCTTCAGCAGG -3'

Sequencing Primer
(F):5'- GACATGTCTCTATTGATTTTGACCTG -3'
(R):5'- TCACCATTCTTCAGCAGGTAAGTAC -3'
Posted On2014-10-30