Incidental Mutation 'R2369:Wdr72'
ID246433
Institutional Source Beutler Lab
Gene Symbol Wdr72
Ensembl Gene ENSMUSG00000044976
Gene NameWD repeat domain 72
Synonyms
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location74110356-74283308 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 74210175 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 723 (K723R)
Ref Sequence ENSEMBL: ENSMUSP00000149349 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055879] [ENSMUST00000215440]
Predicted Effect possibly damaging
Transcript: ENSMUST00000055879
AA Change: K735R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000057320
Gene: ENSMUSG00000044976
AA Change: K735R

DomainStartEndE-ValueType
WD40 4 45 1.24e0 SMART
WD40 51 93 1.54e0 SMART
WD40 143 188 8.22e1 SMART
Blast:WD40 319 363 4e-19 BLAST
WD40 398 443 8.88e0 SMART
WD40 461 506 5.97e-1 SMART
WD40 509 554 9.9e0 SMART
WD40 557 596 2.12e-3 SMART
low complexity region 694 711 N/A INTRINSIC
low complexity region 780 798 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000215440
AA Change: K723R

PolyPhen 2 Score 0.769 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein with eight WD-40 repeats. Mutations in this gene have been associated with amelogenesis imperfecta hypomaturation type 2A3. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Mice homozygous for a null allele display hypomineralized enamel, ameloblast abnormalities and decreased post-weaning body weight. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Atxn7l1 T C 12: 33,358,850 probably null Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Wdr72
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00838:Wdr72 APN 9 74155129 missense probably damaging 1.00
IGL01385:Wdr72 APN 9 74179506 splice site probably benign
IGL01512:Wdr72 APN 9 74148759 missense probably benign 0.02
IGL01544:Wdr72 APN 9 74148725 missense probably damaging 1.00
IGL01938:Wdr72 APN 9 74148774 missense probably benign 0.25
IGL02090:Wdr72 APN 9 74154930 missense possibly damaging 0.87
IGL02121:Wdr72 APN 9 74281729 utr 3 prime probably benign
IGL02140:Wdr72 APN 9 74210223 missense probably benign 0.40
IGL02171:Wdr72 APN 9 74210534 missense possibly damaging 0.94
IGL02208:Wdr72 APN 9 74157299 missense probably damaging 1.00
IGL02936:Wdr72 APN 9 74152580 missense probably damaging 1.00
IGL02979:Wdr72 APN 9 74179556 missense probably damaging 1.00
IGL03263:Wdr72 APN 9 74157429 missense probably damaging 1.00
F5770:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
R0107:Wdr72 UTSW 9 74210433 missense probably damaging 1.00
R0332:Wdr72 UTSW 9 74157252 critical splice acceptor site probably null
R0420:Wdr72 UTSW 9 74210757 missense possibly damaging 0.75
R0536:Wdr72 UTSW 9 74157408 missense probably damaging 1.00
R0565:Wdr72 UTSW 9 74217306 missense probably benign 0.34
R0755:Wdr72 UTSW 9 74145094 missense probably benign 0.05
R1183:Wdr72 UTSW 9 74179585 missense probably benign 0.00
R1636:Wdr72 UTSW 9 74179625 missense probably benign 0.00
R1668:Wdr72 UTSW 9 74210162 missense probably damaging 0.99
R1687:Wdr72 UTSW 9 74210199 missense probably benign 0.13
R1813:Wdr72 UTSW 9 74276016 missense possibly damaging 0.85
R1835:Wdr72 UTSW 9 74151617 missense probably damaging 1.00
R2036:Wdr72 UTSW 9 74151594 missense probably damaging 1.00
R2113:Wdr72 UTSW 9 74145172 missense probably benign 0.07
R2331:Wdr72 UTSW 9 74148326 missense probably damaging 1.00
R3973:Wdr72 UTSW 9 74218697 missense probably benign
R4021:Wdr72 UTSW 9 74151593 missense probably benign 0.18
R4596:Wdr72 UTSW 9 74151605 missense probably benign 0.00
R4665:Wdr72 UTSW 9 74210024 missense probably benign 0.10
R4694:Wdr72 UTSW 9 74179555 missense probably damaging 1.00
R4894:Wdr72 UTSW 9 74210561 missense probably benign 0.00
R5027:Wdr72 UTSW 9 74145976 missense probably damaging 1.00
R5269:Wdr72 UTSW 9 74157371 missense probably damaging 1.00
R5432:Wdr72 UTSW 9 74275946 missense probably damaging 1.00
R5470:Wdr72 UTSW 9 74139699 nonsense probably null
R5717:Wdr72 UTSW 9 74148205 missense probably damaging 1.00
R5793:Wdr72 UTSW 9 74210343 missense probably benign 0.02
R5963:Wdr72 UTSW 9 74145028 missense probably damaging 1.00
R6108:Wdr72 UTSW 9 74151668 missense probably damaging 0.97
R6111:Wdr72 UTSW 9 74210325 missense probably benign 0.00
R6113:Wdr72 UTSW 9 74152641 missense probably benign 0.02
R6245:Wdr72 UTSW 9 74148223 missense probably damaging 1.00
R6469:Wdr72 UTSW 9 74213361 missense probably benign 0.15
R6726:Wdr72 UTSW 9 74152540 missense possibly damaging 0.54
R6857:Wdr72 UTSW 9 74155041 missense probably damaging 1.00
R6916:Wdr72 UTSW 9 74155039 missense probably benign
R6921:Wdr72 UTSW 9 74210646 missense probably benign
R7092:Wdr72 UTSW 9 74210472 missense probably damaging 1.00
R7104:Wdr72 UTSW 9 74148315 missense probably damaging 1.00
V7583:Wdr72 UTSW 9 74157270 missense probably damaging 0.96
X0067:Wdr72 UTSW 9 74152502 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGACCTTTCAATGTCCTGCC -3'
(R):5'- CGCCATGTCTATTGTGAGGC -3'

Sequencing Primer
(F):5'- TCAATGTCCTGCCTGTGAAAAC -3'
(R):5'- CTATTGTGAGGCTGGCATCCAC -3'
Posted On2014-10-30