Incidental Mutation 'R2369:Atxn7l1'
ID246439
Institutional Source Beutler Lab
Gene Symbol Atxn7l1
Ensembl Gene ENSMUSG00000020564
Gene Nameataxin 7-like 1
SynonymsAtxn7l4, 2810423G08Rik
MMRRC Submission 040349-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.163) question?
Stock #R2369 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location33147693-33373185 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 33358850 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000122982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090597] [ENSMUST00000125192] [ENSMUST00000125192] [ENSMUST00000146040] [ENSMUST00000146040] [ENSMUST00000154742]
Predicted Effect probably null
Transcript: ENSMUST00000090597
SMART Domains Protein: ENSMUSP00000088085
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 143 220 2.5e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125192
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000125192
SMART Domains Protein: ENSMUSP00000118777
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 476 488 N/A INTRINSIC
low complexity region 567 597 N/A INTRINSIC
low complexity region 615 634 N/A INTRINSIC
low complexity region 792 810 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138617
Predicted Effect probably null
Transcript: ENSMUST00000146040
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000146040
SMART Domains Protein: ENSMUSP00000122156
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 95 114 N/A INTRINSIC
low complexity region 191 206 N/A INTRINSIC
Pfam:SCA7 246 314 2.3e-28 PFAM
low complexity region 370 384 N/A INTRINSIC
low complexity region 526 540 N/A INTRINSIC
low complexity region 578 590 N/A INTRINSIC
low complexity region 669 699 N/A INTRINSIC
low complexity region 717 736 N/A INTRINSIC
low complexity region 894 912 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000154742
SMART Domains Protein: ENSMUSP00000122982
Gene: ENSMUSG00000020564

DomainStartEndE-ValueType
low complexity region 4 13 N/A INTRINSIC
low complexity region 95 110 N/A INTRINSIC
Pfam:SCA7 150 218 1.3e-31 PFAM
low complexity region 274 288 N/A INTRINSIC
low complexity region 380 392 N/A INTRINSIC
low complexity region 471 501 N/A INTRINSIC
low complexity region 519 538 N/A INTRINSIC
low complexity region 696 714 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700066M21Rik A T 1: 57,382,791 N109Y possibly damaging Het
9230112D13Rik A T 14: 34,511,956 I126N unknown Het
A2ml1 C T 6: 128,580,386 A115T probably benign Het
Ahcyl1 T C 3: 107,670,240 D288G probably damaging Het
Ccdc33 A T 9: 58,076,630 S220T probably benign Het
Celsr3 G A 9: 108,842,552 R2450H probably benign Het
Cubn T A 2: 13,491,217 K69N probably damaging Het
Dclk3 A G 9: 111,488,542 R749G probably benign Het
Dip2a T C 10: 76,313,196 N207S probably benign Het
Dok6 G C 18: 89,414,864 R274G probably null Het
Esco2 G A 14: 65,821,740 A496V probably damaging Het
Gbp5 A T 3: 142,500,719 M55L possibly damaging Het
Grik5 T C 7: 25,058,537 Y373C probably damaging Het
Hbs1l T A 10: 21,307,745 S128R probably benign Het
Ing3 A G 6: 21,950,091 M28V probably damaging Het
Lmtk3 A T 7: 45,795,088 probably benign Het
Met G A 6: 17,531,528 V602I probably benign Het
Ndufaf7 C A 17: 78,945,032 A290E probably damaging Het
Notch4 A G 17: 34,585,950 Q1593R probably benign Het
Npl A G 1: 153,518,877 probably null Het
Paqr6 T C 3: 88,365,953 L84P probably damaging Het
Pros1 A G 16: 62,928,069 Y635C probably damaging Het
Rad1 C A 15: 10,486,659 N47K probably damaging Het
Rassf4 A G 6: 116,638,297 F304L probably damaging Het
Tmem232 A T 17: 65,402,997 V432E probably damaging Het
Wdr72 A G 9: 74,210,175 K723R possibly damaging Het
Xpo7 G A 14: 70,687,731 R493* probably null Het
Zfp11 G A 5: 129,656,465 P644L probably benign Het
Other mutations in Atxn7l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02130:Atxn7l1 APN 12 33342142 missense probably damaging 1.00
IGL02146:Atxn7l1 APN 12 33368031 missense probably benign
IGL02202:Atxn7l1 APN 12 33342078 missense probably benign 0.05
IGL02804:Atxn7l1 APN 12 33367789 missense probably damaging 1.00
IGL03344:Atxn7l1 APN 12 33326066 missense probably damaging 1.00
R0270:Atxn7l1 UTSW 12 33342151 missense possibly damaging 0.58
R0621:Atxn7l1 UTSW 12 33326100 missense probably benign 0.15
R1840:Atxn7l1 UTSW 12 33371033 unclassified probably null
R1856:Atxn7l1 UTSW 12 33358770 missense probably damaging 1.00
R1992:Atxn7l1 UTSW 12 33358744 missense probably damaging 1.00
R1993:Atxn7l1 UTSW 12 33345977 missense probably benign
R2249:Atxn7l1 UTSW 12 33358840 missense probably damaging 1.00
R3695:Atxn7l1 UTSW 12 33358697 missense probably damaging 1.00
R3856:Atxn7l1 UTSW 12 33367600 missense probably damaging 1.00
R3976:Atxn7l1 UTSW 12 33325955 missense probably damaging 1.00
R4151:Atxn7l1 UTSW 12 33364482 missense probably damaging 0.96
R4301:Atxn7l1 UTSW 12 33367238 missense probably damaging 1.00
R4305:Atxn7l1 UTSW 12 33341992 missense probably damaging 0.99
R4411:Atxn7l1 UTSW 12 33194887 intron probably benign
R4763:Atxn7l1 UTSW 12 33358878 intron probably benign
R5049:Atxn7l1 UTSW 12 33358687 missense probably benign 0.00
R5090:Atxn7l1 UTSW 12 33326078 missense probably damaging 1.00
R5134:Atxn7l1 UTSW 12 33372876 missense probably damaging 1.00
R5425:Atxn7l1 UTSW 12 33367120 missense probably damaging 1.00
R6161:Atxn7l1 UTSW 12 33358663 missense possibly damaging 0.62
R6813:Atxn7l1 UTSW 12 33367124 missense probably damaging 0.96
R7248:Atxn7l1 UTSW 12 33367195 missense probably benign 0.26
R7328:Atxn7l1 UTSW 12 33148503 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGCAGCAGTACTTCTTCAAACC -3'
(R):5'- AAGTTGGTTCCCAGGAGCAC -3'

Sequencing Primer
(F):5'- GTACTTCTTCAAACCACAGCGG -3'
(R):5'- GGTTCCCAGGAGCACTTATATAGAC -3'
Posted On2014-10-30