Incidental Mutation 'R2334:Cryz'
ID246516
Institutional Source Beutler Lab
Gene Symbol Cryz
Ensembl Gene ENSMUSG00000028199
Gene Namecrystallin, zeta
SynonymsSez9, quinone reductase, SEZ9
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R2334 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location154596711-154623182 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 154622191 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 310 (A310V)
Ref Sequence ENSEMBL: ENSMUSP00000142105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029850] [ENSMUST00000135723] [ENSMUST00000155232] [ENSMUST00000184537] [ENSMUST00000192462] [ENSMUST00000194876]
Predicted Effect probably benign
Transcript: ENSMUST00000029850
AA Change: A310V

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000029850
Gene: ENSMUSG00000028199
AA Change: A310V

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 3.3e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.3e-30 PFAM
Pfam:ADH_zinc_N_2 192 329 1.7e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000135723
SMART Domains Protein: ENSMUSP00000143311
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
PDB:1YB5|B 1 38 5e-17 PDB
SCOP:d1qora1 9 38 9e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000155232
SMART Domains Protein: ENSMUSP00000118449
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 135 3.5e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000184537
SMART Domains Protein: ENSMUSP00000139387
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 180 4.7e-17 PFAM
Pfam:ADH_zinc_N 160 218 5.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000192462
AA Change: A310V

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000142105
Gene: ENSMUSG00000028199
AA Change: A310V

DomainStartEndE-ValueType
Pfam:ADH_N 35 131 2.8e-16 PFAM
Pfam:ADH_zinc_N 160 290 1.8e-29 PFAM
Pfam:ADH_zinc_N_2 192 329 4.3e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194876
SMART Domains Protein: ENSMUSP00000142101
Gene: ENSMUSG00000028199

DomainStartEndE-ValueType
Pfam:ADH_N 35 139 2.2e-14 PFAM
Pfam:ADH_zinc_N 160 290 1.4e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195292
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Crystallins are separated into two classes: taxon-specific, or enzyme, and ubiquitous. The latter class constitutes the major proteins of vertebrate eye lens and maintains the transparency and refractive index of the lens. The former class is also called phylogenetically-restricted crystallins. This gene encodes a taxon-specific crystallin protein which has NADPH-dependent quinone reductase activity distinct from other known quinone reductases. It lacks alcohol dehydrogenase activity although by similarity it is considered a member of the zinc-containing alcohol dehydrogenase family. Unlike other mammalian species, in humans, lens expression is low. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. One pseudogene is known to exist. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A G 4: 144,528,859 K283R probably damaging Het
Ceacam20 T C 7: 19,971,591 F169S probably damaging Het
Clint1 A G 11: 45,909,028 Q556R probably damaging Het
Cpa5 G A 6: 30,624,606 W148* probably null Het
Dlk1 T C 12: 109,453,688 V10A probably damaging Het
Fbxw16 T G 9: 109,438,361 L267F probably benign Het
Frmpd1 T C 4: 45,285,408 S1410P probably damaging Het
Itgb4 A T 11: 115,993,435 I982F probably damaging Het
Lrrfip2 G A 9: 111,219,725 C250Y probably benign Het
Mia3 A G 1: 183,334,402 probably null Het
Mlh3 T A 12: 85,268,077 D445V probably benign Het
Ndst4 T A 3: 125,708,176 N129K possibly damaging Het
Nlrp2 T A 7: 5,337,535 E93D probably benign Het
Olfm3 T A 3: 115,101,959 Y163* probably null Het
Olfr318 A T 11: 58,720,462 Y195* probably null Het
Olfr483 C T 7: 108,103,348 T13I probably benign Het
Pdzph1 A G 17: 58,922,649 S1005P probably damaging Het
Slc46a2 G A 4: 59,914,150 P258S possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttn T C 2: 76,725,794 E21962G possibly damaging Het
Unc13a T C 8: 71,634,558 D1515G probably damaging Het
Vmn2r70 T C 7: 85,559,592 N559S probably benign Het
Wwp1 A T 4: 19,662,032 I158K probably benign Het
Other mutations in Cryz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Cryz APN 3 154604942 missense possibly damaging 0.95
IGL00838:Cryz APN 3 154618475 missense probably damaging 1.00
IGL00969:Cryz APN 3 154618526 nonsense probably null
IGL01571:Cryz APN 3 154621743 missense probably damaging 1.00
IGL03082:Cryz APN 3 154604926 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R0049:Cryz UTSW 3 154611552 missense probably damaging 1.00
R1116:Cryz UTSW 3 154621603 splice site probably benign
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1470:Cryz UTSW 3 154606476 missense probably damaging 1.00
R1586:Cryz UTSW 3 154611510 missense probably benign 0.00
R2018:Cryz UTSW 3 154621683 missense probably damaging 1.00
R2223:Cryz UTSW 3 154618554 missense possibly damaging 0.86
R4488:Cryz UTSW 3 154618457 splice site probably benign
R5547:Cryz UTSW 3 154611557 nonsense probably null
R5595:Cryz UTSW 3 154606518 missense probably damaging 1.00
R5917:Cryz UTSW 3 154621766 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCATGTGGTCCACTGCCAAG -3'
(R):5'- AGAGTTTTGTGATGCACGCAG -3'

Sequencing Primer
(F):5'- TGGTCCACTGCCAAGAAACAAATG -3'
(R):5'- GATGCACGCAGACCCCATTG -3'
Posted On2014-10-30