Incidental Mutation 'R2334:Nlrp2'
ID246522
Institutional Source Beutler Lab
Gene Symbol Nlrp2
Ensembl Gene ENSMUSG00000035177
Gene NameNLR family, pyrin domain containing 2
SynonymsNbs1, Pan1, PYPAF2, E330007A02Rik, Nalp2
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.136) question?
Stock #R2334 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location5298547-5351035 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 5337535 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 93 (E93D)
Ref Sequence ENSEMBL: ENSMUSP00000045077 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045022]
Predicted Effect probably benign
Transcript: ENSMUST00000045022
AA Change: E93D

PolyPhen 2 Score 0.394 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000045077
Gene: ENSMUSG00000035177
AA Change: E93D

DomainStartEndE-ValueType
PYRIN 7 90 2.88e-17 SMART
Pfam:NACHT 180 348 6.9e-30 PFAM
internal_repeat_1 676 722 1.74e-5 PROSPERO
LRR 796 823 1.26e1 SMART
LRR 825 852 1.18e1 SMART
LRR 853 880 5.81e-2 SMART
LRR 882 909 3.39e-3 SMART
LRR 910 937 5.06e-2 SMART
LRR 939 966 5.23e0 SMART
LRR 967 994 3.58e-2 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the nucleotide-binding and leucine-rich repeat receptor (NLR) family, and is predicted to contain an N-terminal pyrin effector domain (PYD), a centrally-located nucleotide-binding and oligomerization domain (NACHT) and C-terminal leucine-rich repeats (LRR). Members of this gene family are thought to be important regulators of immune responses. This gene product interacts with components of the IkB kinase (IKK) complex, and can regulate both caspase-1 and NF-kB (nuclear factor kappa-light-chain-enhancer of activated B cells) activity. The pyrin domain is necessary and sufficient for suppression of NF-kB activity. An allelic variant (rs147585490) has been found that is incapable of blocking the transcriptional activity of NF-kB. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A G 4: 144,528,859 K283R probably damaging Het
Ceacam20 T C 7: 19,971,591 F169S probably damaging Het
Clint1 A G 11: 45,909,028 Q556R probably damaging Het
Cpa5 G A 6: 30,624,606 W148* probably null Het
Cryz C T 3: 154,622,191 A310V probably benign Het
Dlk1 T C 12: 109,453,688 V10A probably damaging Het
Fbxw16 T G 9: 109,438,361 L267F probably benign Het
Frmpd1 T C 4: 45,285,408 S1410P probably damaging Het
Itgb4 A T 11: 115,993,435 I982F probably damaging Het
Lrrfip2 G A 9: 111,219,725 C250Y probably benign Het
Mia3 A G 1: 183,334,402 probably null Het
Mlh3 T A 12: 85,268,077 D445V probably benign Het
Ndst4 T A 3: 125,708,176 N129K possibly damaging Het
Olfm3 T A 3: 115,101,959 Y163* probably null Het
Olfr318 A T 11: 58,720,462 Y195* probably null Het
Olfr483 C T 7: 108,103,348 T13I probably benign Het
Pdzph1 A G 17: 58,922,649 S1005P probably damaging Het
Slc46a2 G A 4: 59,914,150 P258S possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttn T C 2: 76,725,794 E21962G possibly damaging Het
Unc13a T C 8: 71,634,558 D1515G probably damaging Het
Vmn2r70 T C 7: 85,559,592 N559S probably benign Het
Wwp1 A T 4: 19,662,032 I158K probably benign Het
Other mutations in Nlrp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00485:Nlrp2 APN 7 5337548 missense probably benign 0.00
IGL00545:Nlrp2 APN 7 5328252 missense possibly damaging 0.89
IGL01311:Nlrp2 APN 7 5319239 missense possibly damaging 0.92
IGL01345:Nlrp2 APN 7 5317492 missense probably benign 0.16
IGL01583:Nlrp2 APN 7 5337770 missense probably damaging 1.00
IGL01659:Nlrp2 APN 7 5328035 missense probably damaging 1.00
IGL02240:Nlrp2 APN 7 5327823 missense probably damaging 1.00
IGL02353:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02360:Nlrp2 APN 7 5337599 missense probably damaging 1.00
IGL02399:Nlrp2 APN 7 5328810 missense probably damaging 1.00
IGL02441:Nlrp2 APN 7 5335567 critical splice donor site probably null
IGL02588:Nlrp2 APN 7 5327552 nonsense probably null
IGL02803:Nlrp2 APN 7 5328318 missense probably damaging 1.00
IGL02968:Nlrp2 APN 7 5301025 missense possibly damaging 0.81
IGL03342:Nlrp2 APN 7 5317483 missense probably damaging 1.00
R0027:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R0051:Nlrp2 UTSW 7 5322334 unclassified probably benign
R0079:Nlrp2 UTSW 7 5327730 missense possibly damaging 0.81
R0130:Nlrp2 UTSW 7 5322418 missense possibly damaging 0.77
R0157:Nlrp2 UTSW 7 5308770 missense possibly damaging 0.88
R0201:Nlrp2 UTSW 7 5328329 missense probably benign 0.00
R0276:Nlrp2 UTSW 7 5328109 missense probably benign 0.00
R0288:Nlrp2 UTSW 7 5328545 missense probably benign 0.19
R0332:Nlrp2 UTSW 7 5317630 missense probably damaging 1.00
R0724:Nlrp2 UTSW 7 5319222 missense probably damaging 1.00
R1241:Nlrp2 UTSW 7 5328431 missense probably damaging 1.00
R1355:Nlrp2 UTSW 7 5327491 missense possibly damaging 0.81
R1392:Nlrp2 UTSW 7 5329015 splice site probably benign
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1470:Nlrp2 UTSW 7 5300951 missense probably benign 0.18
R1563:Nlrp2 UTSW 7 5308725 missense probably damaging 1.00
R1866:Nlrp2 UTSW 7 5327716 nonsense probably null
R1942:Nlrp2 UTSW 7 5322448 missense probably damaging 1.00
R1959:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1960:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R1961:Nlrp2 UTSW 7 5327738 missense probably damaging 1.00
R2072:Nlrp2 UTSW 7 5325006 missense probably damaging 1.00
R2161:Nlrp2 UTSW 7 5325042 missense probably damaging 1.00
R2190:Nlrp2 UTSW 7 5319238 missense possibly damaging 0.95
R2243:Nlrp2 UTSW 7 5335598 missense probably benign 0.03
R2277:Nlrp2 UTSW 7 5328129 missense probably benign
R3030:Nlrp2 UTSW 7 5327748 missense probably damaging 1.00
R3404:Nlrp2 UTSW 7 5319287 missense probably benign 0.01
R3941:Nlrp2 UTSW 7 5327552 nonsense probably null
R4021:Nlrp2 UTSW 7 5325012 missense probably benign 0.40
R4518:Nlrp2 UTSW 7 5325056 missense possibly damaging 0.85
R4666:Nlrp2 UTSW 7 5319189 missense probably benign 0.18
R4767:Nlrp2 UTSW 7 5328024 missense probably damaging 1.00
R4827:Nlrp2 UTSW 7 5328951 missense possibly damaging 0.60
R4873:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R4875:Nlrp2 UTSW 7 5298859 missense probably benign 0.09
R5020:Nlrp2 UTSW 7 5328077 missense probably damaging 1.00
R5293:Nlrp2 UTSW 7 5327615 missense probably damaging 1.00
R5310:Nlrp2 UTSW 7 5325008 missense probably benign 0.00
R5336:Nlrp2 UTSW 7 5328119 missense probably benign
R5390:Nlrp2 UTSW 7 5300909 missense probably benign 0.00
R5864:Nlrp2 UTSW 7 5322381 missense probably damaging 1.00
R5913:Nlrp2 UTSW 7 5324903 unclassified probably null
R6173:Nlrp2 UTSW 7 5337809 missense probably damaging 0.96
R6274:Nlrp2 UTSW 7 5317555 missense probably damaging 1.00
R6303:Nlrp2 UTSW 7 5337761 missense probably damaging 1.00
R6343:Nlrp2 UTSW 7 5300926 missense possibly damaging 0.82
R6704:Nlrp2 UTSW 7 5325041 nonsense probably null
R6814:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R6872:Nlrp2 UTSW 7 5308710 missense probably benign 0.01
R7023:Nlrp2 UTSW 7 5328229 nonsense probably null
R7028:Nlrp2 UTSW 7 5328572 missense possibly damaging 0.93
R7109:Nlrp2 UTSW 7 5328617 missense not run
X0027:Nlrp2 UTSW 7 5327642 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CAACTGTGCCTGTGTCTGTG -3'
(R):5'- TTGAGGAGCTGTTCTCTGCC -3'

Sequencing Primer
(F):5'- TCTGAGGCAGAGTATCCAATTGCC -3'
(R):5'- GAGCTGTTCTCTGCCAGATACAATG -3'
Posted On2014-10-30