Incidental Mutation 'R2334:Ceacam20'
ID246523
Institutional Source Beutler Lab
Gene Symbol Ceacam20
Ensembl Gene ENSMUSG00000070777
Gene Namecarcinoembryonic antigen-related cell adhesion molecule 20
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.101) question?
Stock #R2334 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location19965412-19991104 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19971591 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 169 (F169S)
Ref Sequence ENSEMBL: ENSMUSP00000092344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000094753]
Predicted Effect probably damaging
Transcript: ENSMUST00000094753
AA Change: F169S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092344
Gene: ENSMUSG00000070777
AA Change: F169S

DomainStartEndE-ValueType
signal peptide 1 30 N/A INTRINSIC
IG 57 139 1.4e-7 SMART
IGc2 162 220 1.68e-5 SMART
IG 244 326 1.85e-7 SMART
IGc2 349 406 4.67e-4 SMART
transmembrane domain 431 453 N/A INTRINSIC
low complexity region 458 473 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000207248
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A G 4: 144,528,859 K283R probably damaging Het
Clint1 A G 11: 45,909,028 Q556R probably damaging Het
Cpa5 G A 6: 30,624,606 W148* probably null Het
Cryz C T 3: 154,622,191 A310V probably benign Het
Dlk1 T C 12: 109,453,688 V10A probably damaging Het
Fbxw16 T G 9: 109,438,361 L267F probably benign Het
Frmpd1 T C 4: 45,285,408 S1410P probably damaging Het
Itgb4 A T 11: 115,993,435 I982F probably damaging Het
Lrrfip2 G A 9: 111,219,725 C250Y probably benign Het
Mia3 A G 1: 183,334,402 probably null Het
Mlh3 T A 12: 85,268,077 D445V probably benign Het
Ndst4 T A 3: 125,708,176 N129K possibly damaging Het
Nlrp2 T A 7: 5,337,535 E93D probably benign Het
Olfm3 T A 3: 115,101,959 Y163* probably null Het
Olfr318 A T 11: 58,720,462 Y195* probably null Het
Olfr483 C T 7: 108,103,348 T13I probably benign Het
Pdzph1 A G 17: 58,922,649 S1005P probably damaging Het
Slc46a2 G A 4: 59,914,150 P258S possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttn T C 2: 76,725,794 E21962G possibly damaging Het
Unc13a T C 8: 71,634,558 D1515G probably damaging Het
Vmn2r70 T C 7: 85,559,592 N559S probably benign Het
Wwp1 A T 4: 19,662,032 I158K probably benign Het
Other mutations in Ceacam20
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01572:Ceacam20 APN 7 19974274 missense probably damaging 1.00
IGL01574:Ceacam20 APN 7 19974322 missense possibly damaging 0.48
IGL02407:Ceacam20 APN 7 19970407 missense probably benign 0.26
IGL03035:Ceacam20 APN 7 19977908 critical splice donor site probably null
IGL03144:Ceacam20 APN 7 19971519 missense possibly damaging 0.65
R0129:Ceacam20 UTSW 7 19976260 missense probably damaging 1.00
R0573:Ceacam20 UTSW 7 19986668 missense probably damaging 0.97
R0616:Ceacam20 UTSW 7 19970396 missense probably benign 0.01
R1016:Ceacam20 UTSW 7 19976302 missense probably null
R1218:Ceacam20 UTSW 7 19976097 missense probably benign 0.00
R1257:Ceacam20 UTSW 7 19974192 missense probably benign 0.03
R3051:Ceacam20 UTSW 7 19976185 missense probably benign 0.33
R4184:Ceacam20 UTSW 7 19976116 missense probably damaging 1.00
R4667:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4668:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4669:Ceacam20 UTSW 7 19986027 missense probably damaging 1.00
R4953:Ceacam20 UTSW 7 19971726 missense probably damaging 1.00
R5000:Ceacam20 UTSW 7 19965528 missense probably damaging 0.98
R5450:Ceacam20 UTSW 7 19978208 missense possibly damaging 0.94
R5561:Ceacam20 UTSW 7 19970393 missense possibly damaging 0.90
R6118:Ceacam20 UTSW 7 19971729 missense possibly damaging 0.90
R6414:Ceacam20 UTSW 7 19976131 missense probably damaging 1.00
R6970:Ceacam20 UTSW 7 19989977 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGATCCCACCTCTATCAGATCC -3'
(R):5'- GACTTTGACCACACCTAGGC -3'

Sequencing Primer
(F):5'- ACCACCCTTATAACTAAATGGAGAAG -3'
(R):5'- CACCTAGGCGGGACAAGTTG -3'
Posted On2014-10-30