Incidental Mutation 'R2334:Fbxw16'
ID246527
Institutional Source Beutler Lab
Gene Symbol Fbxw16
Ensembl Gene ENSMUSG00000074062
Gene NameF-box and WD-40 domain protein 16
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R2334 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109432316-109449140 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 109438361 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 267 (L267F)
Ref Sequence ENSEMBL: ENSMUSP00000082051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084984]
Predicted Effect probably benign
Transcript: ENSMUST00000084984
AA Change: L267F

PolyPhen 2 Score 0.159 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000082051
Gene: ENSMUSG00000074062
AA Change: L267F

DomainStartEndE-ValueType
FBOX 5 45 2.72e-6 SMART
SCOP:d1e1aa_ 128 249 3e-5 SMART
Blast:WD40 137 176 1e-7 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196410
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196515
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 23 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9430007A20Rik A G 4: 144,528,859 K283R probably damaging Het
Ceacam20 T C 7: 19,971,591 F169S probably damaging Het
Clint1 A G 11: 45,909,028 Q556R probably damaging Het
Cpa5 G A 6: 30,624,606 W148* probably null Het
Cryz C T 3: 154,622,191 A310V probably benign Het
Dlk1 T C 12: 109,453,688 V10A probably damaging Het
Frmpd1 T C 4: 45,285,408 S1410P probably damaging Het
Itgb4 A T 11: 115,993,435 I982F probably damaging Het
Lrrfip2 G A 9: 111,219,725 C250Y probably benign Het
Mia3 A G 1: 183,334,402 probably null Het
Mlh3 T A 12: 85,268,077 D445V probably benign Het
Ndst4 T A 3: 125,708,176 N129K possibly damaging Het
Nlrp2 T A 7: 5,337,535 E93D probably benign Het
Olfm3 T A 3: 115,101,959 Y163* probably null Het
Olfr318 A T 11: 58,720,462 Y195* probably null Het
Olfr483 C T 7: 108,103,348 T13I probably benign Het
Pdzph1 A G 17: 58,922,649 S1005P probably damaging Het
Slc46a2 G A 4: 59,914,150 P258S possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Ttn T C 2: 76,725,794 E21962G possibly damaging Het
Unc13a T C 8: 71,634,558 D1515G probably damaging Het
Vmn2r70 T C 7: 85,559,592 N559S probably benign Het
Wwp1 A T 4: 19,662,032 I158K probably benign Het
Other mutations in Fbxw16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02139:Fbxw16 APN 9 109436686 missense probably benign 0.34
IGL02801:Fbxw16 APN 9 109441076 missense possibly damaging 0.73
milky_way UTSW 9 109441250 missense probably damaging 1.00
R0041:Fbxw16 UTSW 9 109448164 missense probably damaging 1.00
R0245:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R0389:Fbxw16 UTSW 9 109432482 missense probably benign 0.03
R0652:Fbxw16 UTSW 9 109436168 missense possibly damaging 0.93
R1693:Fbxw16 UTSW 9 109436259 missense possibly damaging 0.74
R1772:Fbxw16 UTSW 9 109439582 missense possibly damaging 0.91
R1965:Fbxw16 UTSW 9 109441221 missense probably damaging 1.00
R2190:Fbxw16 UTSW 9 109436671 missense probably damaging 1.00
R3800:Fbxw16 UTSW 9 109436597 missense probably damaging 0.99
R3976:Fbxw16 UTSW 9 109439629 missense probably benign 0.42
R4298:Fbxw16 UTSW 9 109446557 missense probably benign 0.00
R4914:Fbxw16 UTSW 9 109438177 missense probably benign 0.01
R4948:Fbxw16 UTSW 9 109438347 missense probably damaging 1.00
R4995:Fbxw16 UTSW 9 109441250 missense probably damaging 1.00
R5057:Fbxw16 UTSW 9 109441164 missense probably damaging 1.00
R5077:Fbxw16 UTSW 9 109441049 critical splice donor site probably null
R5111:Fbxw16 UTSW 9 109436728 missense probably benign 0.11
R5294:Fbxw16 UTSW 9 109436644 missense probably benign 0.34
R5901:Fbxw16 UTSW 9 109441217 missense probably benign 0.06
R6295:Fbxw16 UTSW 9 109448769 intron probably benign
R6303:Fbxw16 UTSW 9 109449101 missense probably benign 0.00
R6664:Fbxw16 UTSW 9 109438258 missense probably benign 0.27
R6670:Fbxw16 UTSW 9 109438212 missense probably damaging 1.00
R6890:Fbxw16 UTSW 9 109436742 missense probably benign 0.14
R7056:Fbxw16 UTSW 9 109436284 missense possibly damaging 0.50
R7073:Fbxw16 UTSW 9 109441055 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCTACTATTGGGCACATGC -3'
(R):5'- TGGGAGCAATGACAGTTCTAACC -3'

Sequencing Primer
(F):5'- TCTGCCTTGAGAACTTTCTAAGG -3'
(R):5'- TCTAACCTGTCCTGGGTGAAGAAC -3'
Posted On2014-10-30