Mutagenetix > Incidental Mutation

Incidental Mutation 'R2336:Arhgap21'

246542

Institutional Source

Beutler Lab

Gene Symbol

Arhgap21

Ensembl Gene

ENSMUSG00000036591

Gene Name

Rho GTPase activating protein 21

Synonyms

ARHGAP10, 5530401C11Rik

MMRRC Submission

040323-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.442) question?

Stock #

R2336 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

20852730-20973692 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 20884862 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 772 (R772C)

Ref Sequence

ENSEMBL: ENSMUSP00000133851 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000114594] [ENSMUST00000141298] [ENSMUST00000154230] [ENSMUST00000173194] [ENSMUST00000174584]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000114594
AA Change: R776C

PolyPhen 2 Score 0.169 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000110241
Gene: ENSMUSG00000036591
AA Change: R776C

Domain	Start	End	E-Value	Type
PDZ	58	159	1.03e-16	SMART
low complexity region	351	362	N/A	INTRINSIC
low complexity region	445	459	N/A	INTRINSIC
low complexity region	625	635	N/A	INTRINSIC
low complexity region	911	925	N/A	INTRINSIC
PH	930	1040	2.09e-16	SMART
RhoGAP	1157	1334	3.26e-62	SMART
low complexity region	1381	1399	N/A	INTRINSIC
low complexity region	1448	1466	N/A	INTRINSIC
low complexity region	1533	1565	N/A	INTRINSIC
low complexity region	1573	1593	N/A	INTRINSIC
low complexity region	1891	1900	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000141298
AA Change: R782C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000120357
Gene: ENSMUSG00000036591
AA Change: R782C

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000154230
AA Change: R782C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000122497
Gene: ENSMUSG00000036591
AA Change: R782C

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	357	368	N/A	INTRINSIC
low complexity region	451	465	N/A	INTRINSIC
low complexity region	631	641	N/A	INTRINSIC
low complexity region	917	931	N/A	INTRINSIC
PH	936	1046	2.09e-16	SMART
RhoGAP	1163	1340	3.26e-62	SMART
low complexity region	1387	1405	N/A	INTRINSIC
low complexity region	1454	1472	N/A	INTRINSIC
low complexity region	1539	1571	N/A	INTRINSIC
low complexity region	1579	1599	N/A	INTRINSIC
low complexity region	1897	1906	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000173194
AA Change: R772C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000133851
Gene: ENSMUSG00000036591
AA Change: R772C

Domain	Start	End	E-Value	Type
PDZ	64	165	1.03e-16	SMART
low complexity region	347	358	N/A	INTRINSIC
low complexity region	441	455	N/A	INTRINSIC
low complexity region	621	631	N/A	INTRINSIC
low complexity region	907	921	N/A	INTRINSIC
PH	926	1036	2.09e-16	SMART
RhoGAP	1153	1330	3.26e-62	SMART
low complexity region	1377	1395	N/A	INTRINSIC
low complexity region	1444	1462	N/A	INTRINSIC
low complexity region	1529	1561	N/A	INTRINSIC
low complexity region	1569	1589	N/A	INTRINSIC
low complexity region	1887	1896	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000174584
AA Change: R611C

PolyPhen 2 Score 0.275 (Sensitivity: 0.91; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000133347
Gene: ENSMUSG00000036591
AA Change: R611C

Domain	Start	End	E-Value	Type
low complexity region	186	197	N/A	INTRINSIC
low complexity region	280	294	N/A	INTRINSIC
low complexity region	460	470	N/A	INTRINSIC
low complexity region	746	760	N/A	INTRINSIC
PH	765	875	2.09e-16	SMART
RhoGAP	992	1169	3.26e-62	SMART

Meta Mutation Damage Score

0.2020

Coding Region Coverage

1x: 99.2%
3x: 98.7%
10x: 97.4%
20x: 95.2%

Validation Efficiency

100% (38/38)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] ARHGAP21 functions preferentially as a GTPase-activating protein (GAP) for CDC42 (MIM 116952) and regulates the ARP2/3 complex (MIM 604221) and F-actin dynamics at the Golgi through control of CDC42 activity (Dubois et al., 2005 [PubMed 15793564]).[supplied by OMIM, Mar 2008]

Allele List at MGI

Other mutations in this stock

Total: 35 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430110L20Rik	T	A	1: 181,055,206 (GRCm39)		noncoding transcript	Het
Arid2	A	G	15: 96,260,430 (GRCm39)	E393G	probably damaging	Het
Atrn	C	T	2: 130,799,874 (GRCm39)	T417I	probably damaging	Het
Baiap3	T	C	17: 25,469,378 (GRCm39)	K173R	probably damaging	Het
Bdp1	A	T	13: 100,189,510 (GRCm39)	N1497K	probably damaging	Het
Ceacam5	T	C	7: 17,481,300 (GRCm39)	V349A	probably benign	Het
Chrnd	T	C	1: 87,122,615 (GRCm39)	F132S	probably damaging	Het
Ddx42	A	G	11: 106,121,976 (GRCm39)	M164V	possibly damaging	Het
Dtwd2	A	G	18: 49,833,320 (GRCm39)		probably benign	Het
Eprs1	T	A	1: 185,143,571 (GRCm39)		probably benign	Het
Fut8	A	G	12: 77,459,730 (GRCm39)		probably benign	Het
Gabrr3	C	T	16: 59,250,313 (GRCm39)	T104M	probably damaging	Het
Gcat	G	A	15: 78,915,180 (GRCm39)	R16H	probably benign	Het
Gnb2	A	T	5: 137,527,460 (GRCm39)	W125R	probably damaging	Het
Grik4	C	T	9: 42,477,651 (GRCm39)	D512N	probably damaging	Het
Hnf4g	T	C	3: 3,706,284 (GRCm39)	F60L	probably benign	Het
Lrp6	A	G	6: 134,484,546 (GRCm39)	I359T	probably damaging	Het
Lrrfip2	A	G	9: 111,051,283 (GRCm39)	D325G	probably damaging	Het
Mttp	A	T	3: 137,821,856 (GRCm39)	I222K	possibly damaging	Het
Myom1	A	T	17: 71,330,189 (GRCm39)	H107L	possibly damaging	Het
Obi1	G	A	14: 104,716,318 (GRCm39)	P685L	probably damaging	Het
Or10al4	A	T	17: 38,037,689 (GRCm39)	Y258F	probably benign	Het
Or2r11	A	G	6: 42,437,663 (GRCm39)	C97R	probably damaging	Het
Ppfia3	T	C	7: 45,006,121 (GRCm39)		probably null	Het
Prokr2	A	T	2: 132,223,359 (GRCm39)	M61K	probably damaging	Het
Ptk2	A	G	15: 73,137,965 (GRCm39)	C502R	probably damaging	Het
Rbm25	T	A	12: 83,698,192 (GRCm39)	W172R	probably damaging	Het
Rdh16f1	A	G	10: 127,624,624 (GRCm39)	K154R	probably benign	Het
Rnf213	G	A	11: 119,305,430 (GRCm39)	E554K	probably benign	Het
St3gal6	A	T	16: 58,314,067 (GRCm39)	I22K	probably damaging	Het
Tut7	G	T	13: 59,946,868 (GRCm39)	P585Q	probably damaging	Het
Usp43	G	A	11: 67,782,258 (GRCm39)	R387*	probably null	Het
Vmn2r106	T	C	17: 20,488,470 (GRCm39)	N643S	probably benign	Het
Zdbf2	G	T	1: 63,342,623 (GRCm39)	R334L	probably benign	Het
Zfp868	G	T	8: 70,066,558 (GRCm39)		probably null	Het

Other mutations in Arhgap21

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01382:Arhgap21	APN	2	20,860,511 (GRCm39)	missense	probably damaging	1.00
IGL01472:Arhgap21	APN	2	20,854,392 (GRCm39)	missense	probably damaging	1.00
IGL01634:Arhgap21	APN	2	20,919,455 (GRCm39)	missense	probably benign	0.00
IGL01766:Arhgap21	APN	2	20,854,448 (GRCm39)	missense	possibly damaging	0.68
IGL02097:Arhgap21	APN	2	20,884,813 (GRCm39)	missense	probably benign	0.39
IGL02197:Arhgap21	APN	2	20,885,117 (GRCm39)	missense	probably benign
IGL02264:Arhgap21	APN	2	20,864,850 (GRCm39)	splice site	probably null
IGL02346:Arhgap21	APN	2	20,884,762 (GRCm39)	splice site	probably benign
IGL02418:Arhgap21	APN	2	20,885,711 (GRCm39)	missense	probably damaging	1.00
IGL02605:Arhgap21	APN	2	20,860,399 (GRCm39)	missense	probably damaging	1.00
IGL02701:Arhgap21	APN	2	20,896,902 (GRCm39)	missense	probably damaging	1.00
IGL03019:Arhgap21	APN	2	20,865,874 (GRCm39)	missense	probably damaging	1.00
IGL03085:Arhgap21	APN	2	20,919,532 (GRCm39)	missense	probably benign
IGL03265:Arhgap21	APN	2	20,854,439 (GRCm39)	missense	probably benign	0.03
IGL03379:Arhgap21	APN	2	20,885,500 (GRCm39)	missense	probably benign	0.41
R0304:Arhgap21	UTSW	2	20,864,612 (GRCm39)	splice site	probably benign
R0363:Arhgap21	UTSW	2	20,885,944 (GRCm39)	missense	probably damaging	1.00
R0498:Arhgap21	UTSW	2	20,867,928 (GRCm39)	missense	probably damaging	1.00
R0539:Arhgap21	UTSW	2	20,919,610 (GRCm39)	nonsense	probably null
R0633:Arhgap21	UTSW	2	20,860,198 (GRCm39)	nonsense	probably null
R0905:Arhgap21	UTSW	2	20,854,745 (GRCm39)	missense	possibly damaging	0.88
R1550:Arhgap21	UTSW	2	20,886,576 (GRCm39)	nonsense	probably null
R1570:Arhgap21	UTSW	2	20,885,651 (GRCm39)	missense	probably benign
R1686:Arhgap21	UTSW	2	20,886,659 (GRCm39)	missense	probably damaging	1.00
R1746:Arhgap21	UTSW	2	20,865,910 (GRCm39)	missense	probably damaging	0.99
R1864:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R1865:Arhgap21	UTSW	2	20,866,015 (GRCm39)	missense	probably damaging	1.00
R2209:Arhgap21	UTSW	2	20,854,331 (GRCm39)	missense	probably damaging	1.00
R2211:Arhgap21	UTSW	2	20,886,451 (GRCm39)	missense	possibly damaging	0.56
R2276:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2277:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2279:Arhgap21	UTSW	2	20,868,037 (GRCm39)	missense	possibly damaging	0.94
R2516:Arhgap21	UTSW	2	20,859,809 (GRCm39)	missense	probably damaging	1.00
R3722:Arhgap21	UTSW	2	20,855,102 (GRCm39)	missense	probably damaging	1.00
R3877:Arhgap21	UTSW	2	20,864,717 (GRCm39)	missense	probably damaging	0.99
R4017:Arhgap21	UTSW	2	20,896,915 (GRCm39)	missense	probably benign	0.10
R4232:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4233:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4234:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4235:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4236:Arhgap21	UTSW	2	20,891,948 (GRCm39)	missense	probably damaging	1.00
R4434:Arhgap21	UTSW	2	20,972,146 (GRCm39)	missense	probably benign
R4686:Arhgap21	UTSW	2	20,868,033 (GRCm39)	missense	probably damaging	1.00
R4817:Arhgap21	UTSW	2	20,854,967 (GRCm39)	missense	probably benign
R4834:Arhgap21	UTSW	2	20,870,130 (GRCm39)	missense	probably damaging	1.00
R4845:Arhgap21	UTSW	2	20,885,998 (GRCm39)	missense	probably damaging	0.99
R4889:Arhgap21	UTSW	2	20,885,279 (GRCm39)	missense	probably benign	0.10
R4904:Arhgap21	UTSW	2	20,854,872 (GRCm39)	missense	probably benign	0.00
R4911:Arhgap21	UTSW	2	20,863,800 (GRCm39)	missense	probably damaging	1.00
R4994:Arhgap21	UTSW	2	20,854,701 (GRCm39)	missense	probably benign	0.00
R5067:Arhgap21	UTSW	2	20,884,848 (GRCm39)	missense	probably damaging	1.00
R5086:Arhgap21	UTSW	2	20,853,645 (GRCm39)	missense	probably benign	0.00
R5281:Arhgap21	UTSW	2	20,854,127 (GRCm39)	missense	probably damaging	1.00
R5364:Arhgap21	UTSW	2	20,854,533 (GRCm39)	missense	probably damaging	1.00
R5420:Arhgap21	UTSW	2	20,885,897 (GRCm39)	missense	probably damaging	0.99
R5476:Arhgap21	UTSW	2	20,885,497 (GRCm39)	missense	probably benign	0.06
R5831:Arhgap21	UTSW	2	20,868,024 (GRCm39)	missense	probably damaging	1.00
R5949:Arhgap21	UTSW	2	20,853,852 (GRCm39)	missense	probably damaging	0.97
R5994:Arhgap21	UTSW	2	20,886,187 (GRCm39)	missense	possibly damaging	0.78
R6014:Arhgap21	UTSW	2	20,886,616 (GRCm39)	missense	probably damaging	1.00
R6739:Arhgap21	UTSW	2	20,885,543 (GRCm39)	missense	possibly damaging	0.94
R6817:Arhgap21	UTSW	2	20,885,107 (GRCm39)	missense	probably benign	0.23
R6821:Arhgap21	UTSW	2	20,853,659 (GRCm39)	missense	probably benign
R6844:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.00
R6870:Arhgap21	UTSW	2	20,885,321 (GRCm39)	missense	probably damaging	1.00
R6891:Arhgap21	UTSW	2	20,855,142 (GRCm39)	missense	probably damaging	0.97
R7011:Arhgap21	UTSW	2	20,853,689 (GRCm39)	missense	possibly damaging	0.65
R7144:Arhgap21	UTSW	2	20,870,198 (GRCm39)	missense	probably benign
R7237:Arhgap21	UTSW	2	20,854,783 (GRCm39)	nonsense	probably null
R7261:Arhgap21	UTSW	2	20,885,177 (GRCm39)	missense	probably benign
R7558:Arhgap21	UTSW	2	20,860,421 (GRCm39)	missense	probably damaging	1.00
R7566:Arhgap21	UTSW	2	20,917,102 (GRCm39)	missense	probably benign	0.17
R7738:Arhgap21	UTSW	2	20,855,169 (GRCm39)	missense	probably damaging	1.00
R7738:Arhgap21	UTSW	2	20,854,290 (GRCm39)	missense	probably damaging	1.00
R7820:Arhgap21	UTSW	2	20,867,983 (GRCm39)	missense	probably damaging	1.00
R7822:Arhgap21	UTSW	2	20,885,524 (GRCm39)	missense	possibly damaging	0.80
R7965:Arhgap21	UTSW	2	20,854,007 (GRCm39)	missense	probably damaging	1.00
R7986:Arhgap21	UTSW	2	20,867,967 (GRCm39)	missense	probably damaging	1.00
R8028:Arhgap21	UTSW	2	20,885,216 (GRCm39)	missense	probably benign	0.02
R8209:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8226:Arhgap21	UTSW	2	20,876,556 (GRCm39)	missense	probably damaging	1.00
R8251:Arhgap21	UTSW	2	20,854,221 (GRCm39)	missense	probably benign
R8486:Arhgap21	UTSW	2	20,865,236 (GRCm39)	missense	probably damaging	1.00
R8487:Arhgap21	UTSW	2	20,886,116 (GRCm39)	missense	probably benign	0.08
R8508:Arhgap21	UTSW	2	20,858,991 (GRCm39)	missense	probably benign	0.17
R8835:Arhgap21	UTSW	2	20,972,144 (GRCm39)	nonsense	probably null
R9140:Arhgap21	UTSW	2	20,886,025 (GRCm39)	missense	probably damaging	1.00
R9190:Arhgap21	UTSW	2	20,858,983 (GRCm39)	missense	probably null	0.04
R9204:Arhgap21	UTSW	2	20,885,816 (GRCm39)	missense	probably damaging	1.00
R9227:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9230:Arhgap21	UTSW	2	20,860,469 (GRCm39)	missense	possibly damaging	0.92
R9308:Arhgap21	UTSW	2	20,854,061 (GRCm39)	missense	probably damaging	0.99
R9374:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9449:Arhgap21	UTSW	2	20,885,464 (GRCm39)	missense	probably benign
R9454:Arhgap21	UTSW	2	20,870,153 (GRCm39)	missense	probably damaging	0.99
R9499:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9544:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9552:Arhgap21	UTSW	2	20,886,397 (GRCm39)	missense	probably damaging	1.00
R9567:Arhgap21	UTSW	2	20,896,953 (GRCm39)	missense	possibly damaging	0.94
R9588:Arhgap21	UTSW	2	20,858,938 (GRCm39)	missense	possibly damaging	0.73
R9749:Arhgap21	UTSW	2	20,854,026 (GRCm39)	missense	probably benign	0.00
Z1191:Arhgap21	UTSW	2	20,886,283 (GRCm39)	missense	probably benign	0.30

Predicted Primers

PCR Primer
(F):5'- CAGTTTAAGATTTCTGTGCCTATGG -3'
(R):5'- TACCTGCCATCCCAAGGAATG -3'

Sequencing Primer
(F):5'- CTGTGCCTATGGAATACAAATACTC -3'
(R):5'- AAACTTACAGGAGGCTGAAATTC -3'

Posted On

2014-10-30