Incidental Mutation 'R0285:Otof'
ID24657
Institutional Source Beutler Lab
Gene Symbol Otof
Ensembl Gene ENSMUSG00000062372
Gene Nameotoferlin
Synonyms
MMRRC Submission 038506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.232) question?
Stock #R0285 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location30367062-30461932 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to T at 30379533 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000074171] [ENSMUST00000114747]
Predicted Effect probably null
Transcript: ENSMUST00000074171
SMART Domains Protein: ENSMUSP00000073803
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000114747
SMART Domains Protein: ENSMUSP00000110395
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.8e-1 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
transmembrane domain 1959 1981 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000133509
SMART Domains Protein: ENSMUSP00000120591
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 269 367 3.76e-11 SMART
FerI 353 424 7.91e-38 SMART
C2 432 543 1.75e-11 SMART
low complexity region 622 633 N/A INTRINSIC
FerB 856 932 5.13e-46 SMART
C2 975 1082 1.77e-7 SMART
Pfam:C2 1153 1236 1.4e-2 PFAM
low complexity region 1260 1271 N/A INTRINSIC
low complexity region 1288 1318 N/A INTRINSIC
low complexity region 1365 1380 N/A INTRINSIC
low complexity region 1431 1442 N/A INTRINSIC
C2 1488 1587 6.54e-11 SMART
C2 1728 1858 4.02e0 SMART
low complexity region 1903 1915 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144125
SMART Domains Protein: ENSMUSP00000120679
Gene: ENSMUSG00000062372

DomainStartEndE-ValueType
C2 2 97 6.83e-1 SMART
C2 254 352 3.76e-11 SMART
FerI 338 409 7.91e-38 SMART
C2 417 528 1.75e-11 SMART
low complexity region 607 618 N/A INTRINSIC
FerB 841 917 5.13e-46 SMART
C2 960 1067 1.77e-7 SMART
low complexity region 1191 1202 N/A INTRINSIC
low complexity region 1265 1276 N/A INTRINSIC
low complexity region 1293 1323 N/A INTRINSIC
low complexity region 1370 1385 N/A INTRINSIC
low complexity region 1436 1447 N/A INTRINSIC
C2 1493 1592 6.54e-11 SMART
C2 1733 1863 4.02e0 SMART
Pfam:Ferlin_C 1895 1994 7.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150734
Meta Mutation Damage Score 0.574 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mutations in this gene are a cause of neurosensory nonsyndromic recessive deafness, DFNB9. The short form of the encoded protein has 3 C2 domains, a single carboxy-terminal transmembrane domain found also in the C. elegans spermatogenesis factor FER-1 and human dysferlin, while the long form has 6 C2 domains. The homology suggests that this protein may be involved in vesicle membrane fusion. Several transcript variants encoding multiple isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutants have no detectable auditory brainstem response at any frequency tested. Otoacoustic transmission distortion products are detected. Direct electrical stimulation of cochlear ganglia elicits brainstem responses. On depolarization, inner hair cells release almost no neurotransmitter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,533,865 G5S probably damaging Het
Acy3 A G 19: 3,988,193 E162G probably benign Het
Angptl1 T C 1: 156,845,215 S204P probably benign Het
Atf6b C T 17: 34,650,396 probably benign Het
Card11 G A 5: 140,887,101 S619F probably damaging Het
Ccl11 G A 11: 82,062,258 V81I probably damaging Het
Cds1 T C 5: 101,797,038 I126T probably damaging Het
Chd1 A G 17: 17,374,680 probably benign Het
Cndp1 C A 18: 84,618,238 V384F possibly damaging Het
Cuta A G 17: 26,939,449 probably null Het
Diaph3 G A 14: 87,115,024 T47I possibly damaging Het
Dopey1 A T 9: 86,512,639 S598C probably damaging Het
Dsp A G 13: 38,172,794 M217V probably benign Het
Esyt1 T A 10: 128,512,218 I898F possibly damaging Het
Fam189a2 G A 19: 23,979,385 probably benign Het
Fam205a1 G A 4: 42,850,236 T640M probably benign Het
Fam84b T C 15: 60,822,967 H310R probably benign Het
Fgd3 A T 13: 49,263,948 W680R possibly damaging Het
Folh1 A G 7: 86,742,165 probably benign Het
Fuk G C 8: 110,893,717 H235Q probably benign Het
Gadl1 C A 9: 116,030,738 probably benign Het
Garem1 A G 18: 21,129,612 M715T probably benign Het
Gpd2 A T 2: 57,338,955 D257V probably benign Het
Hdac7 A G 15: 97,798,222 probably null Het
Heatr5b A G 17: 78,808,453 M858T probably benign Het
Inpp4b A T 8: 82,034,516 probably benign Het
Iqgap3 G T 3: 88,096,990 C461F probably benign Het
Lamb1 C A 12: 31,326,645 C559* probably null Het
Lrrc31 T C 3: 30,684,948 N308S probably benign Het
Ly75 T C 2: 60,318,319 Y1222C probably damaging Het
Map3k10 C A 7: 27,673,900 R42L probably benign Het
Meioc A G 11: 102,672,191 T72A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp11 T C 10: 75,925,668 Y366C probably damaging Het
N4bp2 T A 5: 65,806,559 D650E probably benign Het
Ncoa6 T C 2: 155,415,701 M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nol4l G A 2: 153,483,853 probably benign Het
Notch1 T G 2: 26,460,861 D2089A possibly damaging Het
Olfr1156 A G 2: 87,950,131 I34T probably damaging Het
Olfr1419 A G 19: 11,871,138 L26P probably damaging Het
Olfr1449 A T 19: 12,935,172 M145L probably benign Het
Olfr155 G A 4: 43,854,398 V30M possibly damaging Het
Olfr493 A G 7: 108,346,499 S161P probably benign Het
Olfr649 A T 7: 104,189,324 Y294* probably null Het
Olfr930 T A 9: 38,930,774 I201N possibly damaging Het
Paox T C 7: 140,129,140 F324L probably damaging Het
Pycr1 A T 11: 120,640,316 I277N probably benign Het
R3hcc1l A T 19: 42,576,129 H627L probably damaging Het
Rab21 G A 10: 115,290,863 S193L probably benign Het
Ralgds T G 2: 28,550,569 probably null Het
Rbm42 A G 7: 30,645,840 S169P possibly damaging Het
Rfpl4 A G 7: 5,110,378 V262A probably benign Het
Rhobtb3 A G 13: 75,877,509 I496T possibly damaging Het
Rnf31 G A 14: 55,601,389 A901T probably damaging Het
Ryr2 T C 13: 11,716,977 D2359G probably damaging Het
Sgo2b A C 8: 63,928,789 Y336* probably null Het
Slc16a7 T A 10: 125,294,631 I62L probably benign Het
Slc22a21 A T 11: 53,959,196 probably benign Het
Slc25a21 A G 12: 56,858,025 probably null Het
Slc5a4b T C 10: 76,062,283 I532M probably damaging Het
Srrm4 C A 5: 116,467,789 probably benign Het
Stxbp1 C A 2: 32,823,542 E27D probably benign Het
Sult2a5 T A 7: 13,628,760 Y131N probably damaging Het
Svopl T C 6: 37,984,522 Q492R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Tmprss11c A G 5: 86,271,430 L90P probably damaging Het
Tmprss6 T A 15: 78,452,868 D346V probably damaging Het
Ubr4 A C 4: 139,440,801 S2820R probably damaging Het
Usp4 T C 9: 108,378,564 V607A probably benign Het
Usp45 A G 4: 21,798,603 probably null Het
Vill C T 9: 119,070,827 probably benign Het
Vmn1r13 C A 6: 57,209,994 T46N probably benign Het
Vmn2r107 A G 17: 20,345,611 T63A probably benign Het
Vmn2r82 T A 10: 79,396,557 W797R probably damaging Het
Washc2 T A 6: 116,221,839 D287E probably damaging Het
Xpc G A 6: 91,498,064 L660F probably damaging Het
Other mutations in Otof
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Otof APN 5 30375904 missense probably damaging 1.00
IGL00391:Otof APN 5 30375623 missense probably damaging 1.00
IGL00579:Otof APN 5 30399322 missense possibly damaging 0.88
IGL00671:Otof APN 5 30385753 critical splice donor site probably null
IGL01019:Otof APN 5 30405216 missense probably benign 0.01
IGL01025:Otof APN 5 30384253 missense possibly damaging 0.82
IGL01086:Otof APN 5 30376273 critical splice donor site probably null
IGL01110:Otof APN 5 30461725 missense probably damaging 1.00
IGL01160:Otof APN 5 30381535 missense probably benign 0.00
IGL01285:Otof APN 5 30405183 missense probably damaging 1.00
IGL01329:Otof APN 5 30441379 missense probably benign 0.00
IGL01337:Otof APN 5 30405777 missense possibly damaging 0.93
IGL01337:Otof APN 5 30419512 missense probably benign 0.17
IGL01834:Otof APN 5 30399220 missense probably damaging 1.00
IGL01872:Otof APN 5 30379254 splice site probably benign
IGL01969:Otof APN 5 30382483 splice site probably benign
IGL02075:Otof APN 5 30370726 missense probably benign 0.23
IGL02077:Otof APN 5 30399235 missense probably damaging 1.00
IGL02136:Otof APN 5 30373992 missense possibly damaging 0.90
IGL02227:Otof APN 5 30370784 missense probably damaging 1.00
IGL02475:Otof APN 5 30376682 missense probably damaging 1.00
IGL02812:Otof APN 5 30374082 missense probably benign 0.08
IGL02864:Otof APN 5 30386341 missense probably damaging 0.99
IGL03176:Otof APN 5 30405176 splice site probably null
R0421:Otof UTSW 5 30371568 missense possibly damaging 0.94
R0570:Otof UTSW 5 30371881 splice site probably benign
R0599:Otof UTSW 5 30370705 missense probably damaging 1.00
R0675:Otof UTSW 5 30382361 missense probably benign 0.01
R0715:Otof UTSW 5 30394697 missense probably damaging 0.99
R1019:Otof UTSW 5 30370743 missense probably damaging 0.96
R1183:Otof UTSW 5 30371912 missense probably damaging 1.00
R1435:Otof UTSW 5 30378695 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1469:Otof UTSW 5 30380227 missense probably benign 0.00
R1474:Otof UTSW 5 30379532 critical splice donor site probably null
R1524:Otof UTSW 5 30379556 missense probably benign 0.03
R1563:Otof UTSW 5 30371005 missense probably benign 0.00
R1732:Otof UTSW 5 30386471 missense probably damaging 1.00
R1822:Otof UTSW 5 30378710 missense probably benign 0.00
R1845:Otof UTSW 5 30371723 nonsense probably null
R1925:Otof UTSW 5 30394188 missense probably benign 0.37
R1938:Otof UTSW 5 30376369 missense probably benign 0.00
R1968:Otof UTSW 5 30388654 missense probably damaging 1.00
R1996:Otof UTSW 5 30421037 missense probably benign 0.01
R1999:Otof UTSW 5 30388772 missense probably benign 0.19
R2027:Otof UTSW 5 30421014 missense probably benign 0.08
R2138:Otof UTSW 5 30461770 missense probably benign 0.01
R2173:Otof UTSW 5 30386374 missense probably damaging 1.00
R2245:Otof UTSW 5 30370207 missense probably damaging 1.00
R3011:Otof UTSW 5 30382840 missense probably damaging 1.00
R3105:Otof UTSW 5 30381801 missense probably benign 0.03
R3442:Otof UTSW 5 30371689 missense probably damaging 1.00
R3710:Otof UTSW 5 30385266 missense probably benign
R3715:Otof UTSW 5 30376871 nonsense probably null
R3806:Otof UTSW 5 30386499 critical splice acceptor site probably null
R3975:Otof UTSW 5 30370712 missense probably damaging 1.00
R4067:Otof UTSW 5 30399291 missense probably damaging 1.00
R4077:Otof UTSW 5 30419506 missense possibly damaging 0.89
R4166:Otof UTSW 5 30382418 missense probably damaging 1.00
R4451:Otof UTSW 5 30385164 missense possibly damaging 0.77
R4485:Otof UTSW 5 30375000 missense possibly damaging 0.77
R4600:Otof UTSW 5 30371900 missense probably damaging 1.00
R4646:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4648:Otof UTSW 5 30383570 missense possibly damaging 0.82
R4669:Otof UTSW 5 30420974 critical splice donor site probably null
R4773:Otof UTSW 5 30394682 missense probably benign 0.05
R4839:Otof UTSW 5 30419404 missense probably damaging 0.99
R4907:Otof UTSW 5 30378661 critical splice donor site probably null
R4961:Otof UTSW 5 30383493 intron probably benign
R4991:Otof UTSW 5 30394181 missense probably damaging 1.00
R5015:Otof UTSW 5 30382894 missense probably damaging 1.00
R5036:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5038:Otof UTSW 5 30384439 missense possibly damaging 0.54
R5253:Otof UTSW 5 30370139 missense probably damaging 1.00
R5336:Otof UTSW 5 30376720 missense probably benign 0.01
R5365:Otof UTSW 5 30381800 missense probably damaging 0.99
R5901:Otof UTSW 5 30374979 missense probably damaging 1.00
R6211:Otof UTSW 5 30371900 missense probably damaging 0.99
R6318:Otof UTSW 5 30414544 missense probably damaging 1.00
R6331:Otof UTSW 5 30371935 missense possibly damaging 0.94
R6671:Otof UTSW 5 30419533 missense probably benign
R6701:Otof UTSW 5 30370797 nonsense probably null
R6792:Otof UTSW 5 30375634 missense probably damaging 1.00
R6853:Otof UTSW 5 30388239 missense probably damaging 1.00
R6940:Otof UTSW 5 30371643 missense probably damaging 0.96
R7037:Otof UTSW 5 30381538 missense probably benign 0.32
R7060:Otof UTSW 5 30388356 missense possibly damaging 0.84
R7089:Otof UTSW 5 30371568 missense possibly damaging 0.94
R7165:Otof UTSW 5 30375620 missense probably damaging 0.99
R7178:Otof UTSW 5 30383534 missense possibly damaging 0.50
R7298:Otof UTSW 5 30388270 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCTGAATGATTCCTATCCACTGCG -3'
(R):5'- ACCTGCTCTTCTGAATGTGAATGCC -3'

Sequencing Primer
(F):5'- ATCCACTGCGGCCATCTG -3'
(R):5'- TTATAGGCAAGAGCAAGGGGC -3'
Posted On2013-04-16