Incidental Mutation 'R2337:Ugcg'
ID246579
Institutional Source Beutler Lab
Gene Symbol Ugcg
Ensembl Gene ENSMUSG00000028381
Gene NameUDP-glucose ceramide glucosyltransferase
SynonymsEpcs21, Ugcgl, GlcT-1
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2337 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location59189257-59222833 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 59207798 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 46 (P46S)
Ref Sequence ENSEMBL: ENSMUSP00000030074 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030074]
Predicted Effect probably benign
Transcript: ENSMUST00000030074
AA Change: P46S

PolyPhen 2 Score 0.175 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030074
Gene: ENSMUSG00000028381
AA Change: P46S

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 51 278 1.3e-26 PFAM
Pfam:Glyco_transf_21 106 278 8.4e-61 PFAM
Pfam:Glyco_trans_2_3 139 368 9.6e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128227
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133996
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155153
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme that catalyzes the first glycosylation step in the biosynthesis of glycosphingolipids, which are membrane components containing lipid and sugar moieties. The product of this reaction is glucosylceramide, which is the core structure of many glycosphingolipids. [provided by RefSeq, Dec 2014]
PHENOTYPE: At embryonic day 7.5, embryos homozygous for a null mutation exhibit decreased size, markedly reduced extraembryonic tissues and a large increase in cells undergoing apoptosis. Mutants die by embryonic day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9930111J21Rik2 T C 11: 49,020,304 N434S probably benign Het
Acaca T C 11: 84,257,197 S691P possibly damaging Het
Arid5b T C 10: 68,097,777 D765G possibly damaging Het
Ccdc14 A G 16: 34,705,018 H179R probably benign Het
Ccdc177 C T 12: 80,758,691 A270T unknown Het
Cdh16 G T 8: 104,622,270 T65K probably benign Het
Dag1 G T 9: 108,207,397 Y848* probably null Het
Dnhd1 C T 7: 105,703,467 T2609I probably benign Het
Fat4 A G 3: 38,980,011 Y2604C probably damaging Het
Fhad1 T C 4: 141,922,344 D164G possibly damaging Het
Fnip1 G A 11: 54,475,737 D109N probably damaging Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm2046 T A 12: 87,980,178 V130E unknown Het
Gsap T A 5: 21,288,630 I755N probably damaging Het
Hdgfl2 T C 17: 56,096,987 V281A possibly damaging Het
Hmg20b T C 10: 81,348,513 E50G probably damaging Het
Myo5a A G 9: 75,203,801 D1498G probably damaging Het
Poc5 T C 13: 96,410,603 V458A probably damaging Het
Tada2b T C 5: 36,476,914 M107V probably benign Het
Tle6 T C 10: 81,592,656 probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Other mutations in Ugcg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01447:Ugcg APN 4 59213865 missense possibly damaging 0.94
IGL01768:Ugcg APN 4 59217216 critical splice donor site probably null
IGL02636:Ugcg APN 4 59207763 missense possibly damaging 0.73
IGL02672:Ugcg APN 4 59218587 splice site probably benign
IGL02798:Ugcg APN 4 59220346 missense probably damaging 1.00
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0013:Ugcg UTSW 4 59213931 missense possibly damaging 0.82
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0068:Ugcg UTSW 4 59217130 missense probably benign 0.16
R0119:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0230:Ugcg UTSW 4 59189739 nonsense probably null
R0299:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0384:Ugcg UTSW 4 59220387 missense possibly damaging 0.91
R0499:Ugcg UTSW 4 59217036 missense possibly damaging 0.85
R0645:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0688:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0726:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0802:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0803:Ugcg UTSW 4 59189685 missense probably benign 0.00
R0811:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0812:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0828:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0831:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0944:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0945:Ugcg UTSW 4 59207798 missense probably benign 0.17
R0947:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1104:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1209:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1210:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1252:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1253:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1255:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1488:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1490:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1548:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1698:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1771:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1776:Ugcg UTSW 4 59207775 missense probably benign 0.05
R1781:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1794:Ugcg UTSW 4 59207798 missense probably benign 0.17
R1840:Ugcg UTSW 4 59219517 missense probably damaging 1.00
R1942:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2228:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2229:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2237:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2239:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2314:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2338:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2340:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2422:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2426:Ugcg UTSW 4 59207798 missense probably benign 0.17
R2433:Ugcg UTSW 4 59207876 missense possibly damaging 0.89
R2680:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3076:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3078:Ugcg UTSW 4 59213922 missense probably damaging 1.00
R3689:Ugcg UTSW 4 59211883 missense probably benign 0.16
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3732:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3733:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3766:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3767:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3768:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3769:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3771:Ugcg UTSW 4 59189690 missense probably benign
R3847:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3848:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3916:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3917:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3958:Ugcg UTSW 4 59207798 missense probably benign 0.17
R3959:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4023:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4024:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4025:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4065:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4066:Ugcg UTSW 4 59207798 missense probably benign 0.17
R4427:Ugcg UTSW 4 59219555 missense probably benign 0.02
R5842:Ugcg UTSW 4 59219545 missense possibly damaging 0.93
R6012:Ugcg UTSW 4 59220272 missense probably damaging 0.96
R6080:Ugcg UTSW 4 59218524 missense possibly damaging 0.70
R6762:Ugcg UTSW 4 59219530 missense possibly damaging 0.86
Y4336:Ugcg UTSW 4 59207798 missense probably benign 0.17
Y4337:Ugcg UTSW 4 59207798 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- AAACAAAAGCCTCTTCCTTGAG -3'
(R):5'- GCCTCATACAGTGTTAAAATTCCC -3'

Sequencing Primer
(F):5'- TTCCTTGAGGTGCCCAGC -3'
(R):5'- CCAAATAAATAAGTAAGCCCACGATG -3'
Posted On2014-10-30