Incidental Mutation 'R2337:Myo5a'
ID246587
Institutional Source Beutler Lab
Gene Symbol Myo5a
Ensembl Gene ENSMUSG00000034593
Gene Namemyosin VA
Synonyms9630007J19Rik, Dbv, flail, MVa, Myo5, MyoVA
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.949) question?
Stock #R2337 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75071015-75223688 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75203801 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1498 (D1498G)
Ref Sequence ENSEMBL: ENSMUSP00000120444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123128] [ENSMUST00000136731] [ENSMUST00000148144] [ENSMUST00000155282]
Predicted Effect probably damaging
Transcript: ENSMUST00000123128
AA Change: D1523G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000116028
Gene: ENSMUSG00000034593
AA Change: D1523G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1364 N/A INTRINSIC
coiled coil region 1406 1443 N/A INTRINSIC
DIL 1685 1790 2.47e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130384
SMART Domains Protein: ENSMUSP00000114803
Gene: ENSMUSG00000034593

DomainStartEndE-ValueType
coiled coil region 95 201 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136604
Predicted Effect probably damaging
Transcript: ENSMUST00000136731
AA Change: D1498G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120444
Gene: ENSMUSG00000034593
AA Change: D1498G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1314 1418 N/A INTRINSIC
DIL 1660 1765 2.47e-51 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000148144
AA Change: D255G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121158
Gene: ENSMUSG00000034593
AA Change: D255G

DomainStartEndE-ValueType
coiled coil region 71 175 N/A INTRINSIC
Blast:DIL 275 305 4e-13 BLAST
Blast:DIL 330 355 5e-6 BLAST
DIL 417 522 2.47e-51 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153404
Predicted Effect probably damaging
Transcript: ENSMUST00000155282
AA Change: D1525G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000117493
Gene: ENSMUSG00000034593
AA Change: D1525G

DomainStartEndE-ValueType
MYSc 63 764 N/A SMART
IQ 765 787 3.65e-4 SMART
IQ 788 810 1.56e-3 SMART
IQ 813 835 3.05e-6 SMART
IQ 836 858 8.38e-4 SMART
IQ 861 883 1.09e-2 SMART
IQ 884 906 6.97e0 SMART
coiled coil region 1153 1234 N/A INTRINSIC
coiled coil region 1339 1445 N/A INTRINSIC
DIL 1687 1792 2.47e-51 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is one of three myosin V heavy-chain genes, belonging to the myosin gene superfamily. Myosin V is a class of actin-based motor proteins involved in cytoplasmic vesicle transport and anchorage, spindle-pole alignment and mRNA translocation. The protein encoded by this gene is abundant in melanocytes and nerve cells. Mutations in this gene cause Griscelli syndrome type-1 (GS1), Griscelli syndrome type-3 (GS3) and neuroectodermal melanolysosomal disease, or Elejalde disease. Multiple alternatively spliced transcript variants encoding different isoforms have been reported, but the full-length nature of some variants has not been determined. [provided by RefSeq, Dec 2008]
PHENOTYPE: Mutations in this gene result in diluted coat color, behavioral deficits including opisthotonus, and postnatal or premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
9930111J21Rik2 T C 11: 49,020,304 N434S probably benign Het
Acaca T C 11: 84,257,197 S691P possibly damaging Het
Arid5b T C 10: 68,097,777 D765G possibly damaging Het
Ccdc14 A G 16: 34,705,018 H179R probably benign Het
Ccdc177 C T 12: 80,758,691 A270T unknown Het
Cdh16 G T 8: 104,622,270 T65K probably benign Het
Dag1 G T 9: 108,207,397 Y848* probably null Het
Dnhd1 C T 7: 105,703,467 T2609I probably benign Het
Fat4 A G 3: 38,980,011 Y2604C probably damaging Het
Fhad1 T C 4: 141,922,344 D164G possibly damaging Het
Fnip1 G A 11: 54,475,737 D109N probably damaging Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm2046 T A 12: 87,980,178 V130E unknown Het
Gsap T A 5: 21,288,630 I755N probably damaging Het
Hdgfl2 T C 17: 56,096,987 V281A possibly damaging Het
Hmg20b T C 10: 81,348,513 E50G probably damaging Het
Poc5 T C 13: 96,410,603 V458A probably damaging Het
Tada2b T C 5: 36,476,914 M107V probably benign Het
Tle6 T C 10: 81,592,656 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Other mutations in Myo5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Myo5a APN 9 75161497 nonsense probably null
IGL00547:Myo5a APN 9 75141453 missense probably benign 0.00
IGL00788:Myo5a APN 9 75168959 missense probably benign 0.15
IGL01327:Myo5a APN 9 75187538 splice site probably benign
IGL01687:Myo5a APN 9 75156249 missense probably benign 0.12
IGL01886:Myo5a APN 9 75169090 splice site probably benign
IGL01945:Myo5a APN 9 75140671 missense probably damaging 1.00
IGL02127:Myo5a APN 9 75212981 missense probably benign 0.12
IGL02137:Myo5a APN 9 75161535 splice site probably null
IGL02183:Myo5a APN 9 75167236 splice site probably benign
IGL02427:Myo5a APN 9 75176618 splice site probably benign
IGL02490:Myo5a APN 9 75136455 missense probably damaging 1.00
IGL02574:Myo5a APN 9 75211147 missense probably benign 0.00
IGL02886:Myo5a APN 9 75151887 splice site probably benign
IGL02961:Myo5a APN 9 75215120 missense probably benign 0.04
IGL03090:Myo5a APN 9 75120833 missense probably damaging 1.00
IGL03119:Myo5a APN 9 75174015 missense probably benign 0.01
IGL03237:Myo5a APN 9 75129994 missense probably damaging 1.00
IGL03296:Myo5a APN 9 75116202 missense probably damaging 1.00
naoki UTSW 9 75161492 missense probably damaging 1.00
new_gray UTSW 9 missense
nut UTSW 9 splice donor site
silver_decerebrate UTSW 9 75164195 missense probably damaging 1.00
silver_decerebrate_2 UTSW 9 75211127 missense probably damaging 1.00
IGL02988:Myo5a UTSW 9 75130141 splice site probably benign
IGL03050:Myo5a UTSW 9 75146909 unclassified probably null
PIT4403001:Myo5a UTSW 9 75217523 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0047:Myo5a UTSW 9 75156207 missense probably damaging 1.00
R0091:Myo5a UTSW 9 75161492 missense probably damaging 1.00
R0142:Myo5a UTSW 9 75160574 missense probably benign 0.01
R0243:Myo5a UTSW 9 75186123 critical splice donor site probably null
R0395:Myo5a UTSW 9 75193977 missense probably benign 0.39
R0427:Myo5a UTSW 9 75174196 missense probably benign 0.00
R0545:Myo5a UTSW 9 75167037 missense possibly damaging 0.94
R0565:Myo5a UTSW 9 75180112 missense probably benign 0.00
R0601:Myo5a UTSW 9 75174015 missense probably benign 0.01
R1457:Myo5a UTSW 9 75213065 missense probably damaging 0.99
R1510:Myo5a UTSW 9 75171551 missense probably benign
R1548:Myo5a UTSW 9 75171746 missense probably damaging 1.00
R1759:Myo5a UTSW 9 75181993 missense possibly damaging 0.72
R1924:Myo5a UTSW 9 75116207 missense probably damaging 1.00
R1960:Myo5a UTSW 9 75147857 missense probably damaging 1.00
R2050:Myo5a UTSW 9 75146874 missense probably benign 0.01
R2070:Myo5a UTSW 9 75181984 missense probably benign 0.03
R2075:Myo5a UTSW 9 75189918 missense probably benign 0.01
R2148:Myo5a UTSW 9 75180147 missense probably damaging 1.00
R2201:Myo5a UTSW 9 75217943 missense possibly damaging 0.51
R2357:Myo5a UTSW 9 75201365 missense probably damaging 0.99
R2392:Myo5a UTSW 9 75209239 missense probably benign 0.02
R2432:Myo5a UTSW 9 75212873 missense possibly damaging 0.89
R2568:Myo5a UTSW 9 75123040 missense probably damaging 1.00
R2568:Myo5a UTSW 9 75151897 missense probably damaging 1.00
R2932:Myo5a UTSW 9 75196136 missense possibly damaging 0.85
R2971:Myo5a UTSW 9 75116202 missense probably damaging 1.00
R4231:Myo5a UTSW 9 75189997 missense possibly damaging 0.67
R4293:Myo5a UTSW 9 75144171 missense probably benign
R4321:Myo5a UTSW 9 75217530 missense probably damaging 0.99
R4450:Myo5a UTSW 9 75167176 missense probably benign 0.00
R4573:Myo5a UTSW 9 75201297 synonymous probably null
R4577:Myo5a UTSW 9 75217545 missense probably damaging 1.00
R4601:Myo5a UTSW 9 75136388 missense probably damaging 1.00
R4690:Myo5a UTSW 9 75153823 missense probably damaging 0.99
R4691:Myo5a UTSW 9 75180156 missense probably damaging 0.99
R4764:Myo5a UTSW 9 75116336 intron probably benign
R4767:Myo5a UTSW 9 75144076 missense probably damaging 0.99
R4811:Myo5a UTSW 9 75141543 critical splice donor site probably null
R4829:Myo5a UTSW 9 75136407 missense probably damaging 1.00
R4863:Myo5a UTSW 9 75217507 missense probably damaging 1.00
R4902:Myo5a UTSW 9 75174078 missense probably benign
R4947:Myo5a UTSW 9 75123048 missense probably damaging 1.00
R5074:Myo5a UTSW 9 75174156 missense probably benign
R5095:Myo5a UTSW 9 75152020 missense probably damaging 1.00
R5095:Myo5a UTSW 9 75184389 nonsense probably null
R5254:Myo5a UTSW 9 75130120 missense probably damaging 1.00
R5267:Myo5a UTSW 9 75152010 missense probably damaging 1.00
R5419:Myo5a UTSW 9 75147897 missense probably damaging 1.00
R5514:Myo5a UTSW 9 75153766 missense probably damaging 1.00
R5629:Myo5a UTSW 9 75203845 missense possibly damaging 0.89
R5649:Myo5a UTSW 9 75171719 missense possibly damaging 0.92
R5661:Myo5a UTSW 9 75167206 missense probably benign 0.02
R5665:Myo5a UTSW 9 75144181 critical splice donor site probably null
R5719:Myo5a UTSW 9 75151931 missense probably damaging 1.00
R5964:Myo5a UTSW 9 75203833 missense probably benign 0.09
R6014:Myo5a UTSW 9 75167207 nonsense probably null
R6344:Myo5a UTSW 9 75160509 missense probably benign 0.09
R6345:Myo5a UTSW 9 75189913 missense possibly damaging 0.77
R6644:Myo5a UTSW 9 75146967 missense probably damaging 0.98
R6712:Myo5a UTSW 9 75212900 missense probably benign 0.12
R6838:Myo5a UTSW 9 75153883 critical splice donor site probably null
R6866:Myo5a UTSW 9 75140688 missense probably damaging 1.00
R6876:Myo5a UTSW 9 75160490 missense probably benign 0.04
R7108:Myo5a UTSW 9 75129992 missense probably damaging 1.00
R7159:Myo5a UTSW 9 75171563 missense probably benign 0.07
R7164:Myo5a UTSW 9 75180153 missense probably benign 0.00
R7219:Myo5a UTSW 9 75120770 missense probably damaging 1.00
X0010:Myo5a UTSW 9 75185905 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTGCTCTGAATGATTGAGCTCTTAC -3'
(R):5'- TGTAGATATGCTGAAAGGCTGG -3'

Sequencing Primer
(F):5'- GAATGATTGAGCTCTTACACAACTG -3'
(R):5'- CTGGAAGGGTTACAGTAGCAAC -3'
Posted On2014-10-30