Incidental Mutation 'R2337:9930111J21Rik2'
ID246591
Institutional Source Beutler Lab
Gene Symbol 9930111J21Rik2
Ensembl Gene ENSMUSG00000069892
Gene NameRIKEN cDNA 9930111J21 gene 2
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R2337 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location49015874-49051242 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 49020304 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 434 (N434S)
Ref Sequence ENSEMBL: ENSMUSP00000098853 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056759] [ENSMUST00000101295] [ENSMUST00000179282]
Predicted Effect probably benign
Transcript: ENSMUST00000056759
SMART Domains Protein: ENSMUSP00000058544
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 1.5e-33 PFAM
Pfam:7tm_4 108 252 1.7e-46 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101295
AA Change: N434S

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000098853
Gene: ENSMUSG00000069892
AA Change: N434S

DomainStartEndE-ValueType
Pfam:IIGP 36 398 2e-125 PFAM
Pfam:DLIC 52 107 3.2e-5 PFAM
Pfam:MMR_HSR1 72 235 2e-11 PFAM
low complexity region 430 444 N/A INTRINSIC
Pfam:IIGP 447 820 2.3e-151 PFAM
Pfam:MMR_HSR1 483 607 5.2e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179282
SMART Domains Protein: ENSMUSP00000136647
Gene: ENSMUSG00000040328

DomainStartEndE-ValueType
Pfam:7tm_4 1 276 3.6e-51 PFAM
Pfam:7TM_GPCR_Srsx 4 227 5.7e-7 PFAM
Pfam:7tm_1 10 259 3.8e-26 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.4%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Acaca T C 11: 84,257,197 S691P possibly damaging Het
Arid5b T C 10: 68,097,777 D765G possibly damaging Het
Ccdc14 A G 16: 34,705,018 H179R probably benign Het
Ccdc177 C T 12: 80,758,691 A270T unknown Het
Cdh16 G T 8: 104,622,270 T65K probably benign Het
Dag1 G T 9: 108,207,397 Y848* probably null Het
Dnhd1 C T 7: 105,703,467 T2609I probably benign Het
Fat4 A G 3: 38,980,011 Y2604C probably damaging Het
Fhad1 T C 4: 141,922,344 D164G possibly damaging Het
Fnip1 G A 11: 54,475,737 D109N probably damaging Het
Gfm1 A G 3: 67,435,514 D127G probably damaging Het
Gm2046 T A 12: 87,980,178 V130E unknown Het
Gsap T A 5: 21,288,630 I755N probably damaging Het
Hdgfl2 T C 17: 56,096,987 V281A possibly damaging Het
Hmg20b T C 10: 81,348,513 E50G probably damaging Het
Myo5a A G 9: 75,203,801 D1498G probably damaging Het
Poc5 T C 13: 96,410,603 V458A probably damaging Het
Tada2b T C 5: 36,476,914 M107V probably benign Het
Tle6 T C 10: 81,592,656 probably null Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Other mutations in 9930111J21Rik2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1986:9930111J21Rik2 UTSW 11 49019292 missense possibly damaging 0.83
R2023:9930111J21Rik2 UTSW 11 49020317 missense probably benign 0.01
R2202:9930111J21Rik2 UTSW 11 49019322 missense probably damaging 1.00
R2205:9930111J21Rik2 UTSW 11 49019322 missense probably damaging 1.00
R3709:9930111J21Rik2 UTSW 11 49019653 missense probably damaging 1.00
R3716:9930111J21Rik2 UTSW 11 49019536 missense probably damaging 0.96
R3738:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R3739:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R4034:9930111J21Rik2 UTSW 11 49019281 nonsense probably null
R5413:9930111J21Rik2 UTSW 11 49020377 missense possibly damaging 0.91
R5595:9930111J21Rik2 UTSW 11 49019711 missense possibly damaging 0.95
R5611:9930111J21Rik2 UTSW 11 49020001 missense possibly damaging 0.91
R5651:9930111J21Rik2 UTSW 11 49019873 missense probably damaging 0.99
R5715:9930111J21Rik2 UTSW 11 49019950 missense probably damaging 1.00
R6169:9930111J21Rik2 UTSW 11 49019261 intron probably null
R6218:9930111J21Rik2 UTSW 11 49019307 missense probably benign 0.06
R6536:9930111J21Rik2 UTSW 11 49019723 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- CTCCCCTCAAGGCATTGATAAAG -3'
(R):5'- ATGGTATCAGCAGCTGAGCTC -3'

Sequencing Primer
(F):5'- GATAAAGCTGGATTTTCCTGTCC -3'
(R):5'- CAGCTGAGCTCCCATTTTATCATAAG -3'
Posted On2014-10-30