Incidental Mutation 'R2338:Actrt3'
List |< first << previous [record 34 of 958] next >> last >|
ID246611
Institutional Source Beutler Lab
Gene Symbol Actrt3
Ensembl Gene ENSMUSG00000037737
Gene Nameactin related protein T3
Synonyms
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.065) question?
Stock #R2338 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location30597073-30599939 bp(-) (GRCm38)
Type of Mutationmakesense
DNA Base Change (assembly) A to G at 30597836 bp
ZygosityHeterozygous
Amino Acid Change Stop codon to Arginine at position 370 (*370R)
Ref Sequence ENSEMBL: ENSMUSP00000048360 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047502] [ENSMUST00000047630] [ENSMUST00000192715] [ENSMUST00000195396] [ENSMUST00000195751]
Predicted Effect probably benign
Transcript: ENSMUST00000047502
SMART Domains Protein: ENSMUSP00000041034
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000047630
AA Change: *370R
SMART Domains Protein: ENSMUSP00000048360
Gene: ENSMUSG00000037737
AA Change: *370R

DomainStartEndE-ValueType
ACTIN 5 369 3.33e-147 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083427
Predicted Effect probably benign
Transcript: ENSMUST00000192715
SMART Domains Protein: ENSMUSP00000141951
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
BTB 24 119 4.44e-22 SMART
low complexity region 174 190 N/A INTRINSIC
ZnF_C2H2 302 324 1.47e-3 SMART
ZnF_C2H2 330 352 5.14e-3 SMART
ZnF_C2H2 358 380 1.36e-2 SMART
ZnF_C2H2 387 409 1.12e-3 SMART
ZnF_C2H2 415 437 3.63e-3 SMART
ZnF_C2H2 443 465 1.1e-2 SMART
ZnF_C2H2 471 493 2.99e-4 SMART
ZnF_C2H2 499 522 3.58e-2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193960
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194587
Predicted Effect probably benign
Transcript: ENSMUST00000195396
SMART Domains Protein: ENSMUSP00000141623
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000195751
SMART Domains Protein: ENSMUSP00000141450
Gene: ENSMUSG00000037730

DomainStartEndE-ValueType
Pfam:BTB 14 55 6.4e-9 PFAM
Meta Mutation Damage Score 0.51 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gne C T 4: 44,042,196 A460T probably damaging Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Actrt3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01433:Actrt3 APN 3 30598039 missense probably damaging 0.99
IGL01783:Actrt3 APN 3 30598475 missense probably benign 0.33
IGL02684:Actrt3 APN 3 30599691 missense probably benign 0.15
R0017:Actrt3 UTSW 3 30598273 missense probably benign 0.00
R0410:Actrt3 UTSW 3 30598124 missense probably benign
R0574:Actrt3 UTSW 3 30599680 missense probably benign 0.21
R1710:Actrt3 UTSW 3 30599752 missense probably damaging 1.00
R1907:Actrt3 UTSW 3 30598567 missense probably damaging 1.00
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R2870:Actrt3 UTSW 3 30599698 missense probably damaging 1.00
R4913:Actrt3 UTSW 3 30598439 missense probably benign
R5683:Actrt3 UTSW 3 30598278 missense probably benign
R5719:Actrt3 UTSW 3 30598127 missense probably benign 0.40
R5942:Actrt3 UTSW 3 30598664 missense possibly damaging 0.50
R6153:Actrt3 UTSW 3 30599750 missense probably damaging 1.00
R6177:Actrt3 UTSW 3 30598167 nonsense probably null
R6741:Actrt3 UTSW 3 30598514 missense possibly damaging 0.85
Predicted Primers PCR Primer
(F):5'- TCCTGCCCTGTTCAGAAGAATC -3'
(R):5'- CTCATTAAGGATGTGGCAAAGC -3'

Sequencing Primer
(F):5'- TCAGTGGTAGAGCACTTAACAGTCC -3'
(R):5'- GCAAAGCTGGCACCTGC -3'
Posted On2014-10-30