Incidental Mutation 'R2338:Gne'
ID246615
Institutional Source Beutler Lab
Gene Symbol Gne
Ensembl Gene ENSMUSG00000028479
Gene Nameglucosamine (UDP-N-acetyl)-2-epimerase/N-acetylmannosamine kinase
Synonyms
MMRRC Submission 040324-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2338 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location44034075-44084177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 44042196 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 460 (A460T)
Ref Sequence ENSEMBL: ENSMUSP00000133521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030201] [ENSMUST00000102936] [ENSMUST00000133709] [ENSMUST00000172533] [ENSMUST00000173234]
Predicted Effect possibly damaging
Transcript: ENSMUST00000030201
AA Change: A491T

PolyPhen 2 Score 0.879 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000030201
Gene: ENSMUSG00000028479
AA Change: A491T

DomainStartEndE-ValueType
Pfam:Epimerase_2 63 406 2.3e-69 PFAM
Pfam:ROK 440 747 1.4e-57 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000102936
AA Change: A460T

PolyPhen 2 Score 0.897 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000100000
Gene: ENSMUSG00000028479
AA Change: A460T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 5.1e-75 PFAM
Pfam:ROK 411 596 6.5e-44 PFAM
low complexity region 685 707 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133709
Predicted Effect possibly damaging
Transcript: ENSMUST00000172533
AA Change: A460T

PolyPhen 2 Score 0.825 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000134040
Gene: ENSMUSG00000028479
AA Change: A460T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 1.6e-75 PFAM
PDB:3EO3|C 406 471 2e-33 PDB
SCOP:d1bu6o1 410 462 1e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173234
AA Change: A460T

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000133521
Gene: ENSMUSG00000028479
AA Change: A460T

DomainStartEndE-ValueType
Pfam:Epimerase_2 32 375 3.9e-75 PFAM
Pfam:ROK 453 522 1.6e-16 PFAM
low complexity region 611 633 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174522
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a bifunctional enzyme that initiates and regulates the biosynthesis of N-acetylneuraminic acid (NeuAc), a precursor of sialic acids. It is a rate-limiting enzyme in the sialic acid biosynthetic pathway. Sialic acid modification of cell surface molecules is crucial for their function in many biologic processes, including cell adhesion and signal transduction. Differential sialylation of cell surface molecules is also implicated in the tumorigenicity and metastatic behavior of malignant cells. Mutations in this gene are associated with sialuria, autosomal recessive inclusion body myopathy, and Nonaka myopathy. Alternative splicing of this gene results in transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes a block in sialic acid biosynthesis and early embryonic lethality. A knockout mouse expressing the human V572L mutation shows features similar to distal myopathy with rimmed vacuoles or hereditary inclusion body myopathy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 52 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930474N05Rik A G 14: 36,095,152 D53G probably benign Het
4931440F15Rik C A 11: 29,823,718 A580S probably benign Het
A1cf C T 19: 31,932,545 P330S probably benign Het
A830010M20Rik T C 5: 107,510,574 L1158S probably damaging Het
Acta2 A G 19: 34,248,541 probably benign Het
Actrt3 A G 3: 30,597,836 *370R probably null Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Cadps2 C G 6: 23,838,978 probably benign Het
Camsap3 C T 8: 3,606,808 R1048C probably damaging Het
Cdkl2 C T 5: 92,033,679 A148T possibly damaging Het
Dab2 T A 15: 6,435,252 I395K possibly damaging Het
Dclk2 A G 3: 86,799,017 F589S probably damaging Het
Ddx60 T C 8: 62,012,436 S1376P possibly damaging Het
Eprs T C 1: 185,415,808 F1256L probably damaging Het
Etaa1 A T 11: 17,945,605 probably null Het
Fat2 T C 11: 55,311,901 T116A possibly damaging Het
Fmnl3 T C 15: 99,370,227 T26A probably benign Het
Foxp1 A G 6: 99,003,293 V158A possibly damaging Het
G6pd2 T A 5: 61,810,008 D375E probably benign Het
Gprin1 T A 13: 54,738,425 probably null Het
Hecw2 T C 1: 53,904,422 M949V possibly damaging Het
Herc1 G A 9: 66,428,969 V1599M possibly damaging Het
Hk2 A C 6: 82,731,115 N628K probably damaging Het
Hmcn1 T C 1: 150,622,934 T4065A possibly damaging Het
Ipo8 T A 6: 148,789,823 Q683L probably benign Het
Krt81 A G 15: 101,463,336 I121T probably benign Het
Lamb2 T C 9: 108,482,141 L322P probably benign Het
Lilrb4a A G 10: 51,491,700 M113V probably benign Het
Mnat1 G A 12: 73,219,143 probably null Het
Mucl1 T A 15: 103,753,698 T68S possibly damaging Het
Npnt G T 3: 132,891,409 D461E probably damaging Het
Nrp1 A T 8: 128,497,904 Q716L probably benign Het
Olfr358 T G 2: 37,005,147 S156R probably damaging Het
Olfr623 A T 7: 103,660,410 I280N possibly damaging Het
Olfr741 A G 14: 50,485,640 T61A possibly damaging Het
Podxl2 T C 6: 88,849,196 Q376R probably damaging Het
Pudp T C 18: 50,568,575 D29G probably benign Het
Rrs1 C A 1: 9,545,801 probably null Het
S1pr3 T C 13: 51,419,578 I265T possibly damaging Het
Scgb1b2 A T 7: 31,291,613 C23* probably null Het
Spag8 G T 4: 43,652,826 R212S probably benign Het
Tacc2 A G 7: 130,733,569 probably null Het
Trmt1l C T 1: 151,428,959 probably benign Het
Trpa1 A T 1: 14,884,245 L810Q probably damaging Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Ugt3a1 T A 15: 9,291,973 probably benign Het
Vmn2r23 T G 6: 123,704,425 I97M possibly damaging Het
Vmn2r65 A T 7: 84,940,843 F622I possibly damaging Het
Vps13a C T 19: 16,720,453 G766E probably damaging Het
Wnk1 T C 6: 119,969,534 T553A probably benign Het
Xirp2 T A 2: 67,510,770 D1118E probably damaging Het
Zfyve9 A C 4: 108,660,614 D461E probably damaging Het
Other mutations in Gne
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01451:Gne APN 4 44041860 intron probably null
IGL02028:Gne APN 4 44066852 missense probably damaging 1.00
IGL02106:Gne APN 4 44037306 missense probably damaging 1.00
IGL02216:Gne APN 4 44044761 missense probably benign 0.43
IGL03095:Gne APN 4 44055211 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0069:Gne UTSW 4 44060099 missense probably damaging 1.00
R0310:Gne UTSW 4 44060157 nonsense probably null
R0606:Gne UTSW 4 44042244 missense possibly damaging 0.55
R0658:Gne UTSW 4 44039033 missense possibly damaging 0.85
R1878:Gne UTSW 4 44040434 missense probably damaging 1.00
R2009:Gne UTSW 4 44055273 missense probably benign 0.00
R4043:Gne UTSW 4 44040383 missense possibly damaging 0.65
R4361:Gne UTSW 4 44059947 missense possibly damaging 0.63
R4725:Gne UTSW 4 44066806 missense probably benign 0.31
R4869:Gne UTSW 4 44055204 critical splice donor site probably null
R5511:Gne UTSW 4 44041843 missense probably damaging 0.99
R5797:Gne UTSW 4 44060030 missense probably damaging 1.00
R6016:Gne UTSW 4 44039063 missense probably damaging 0.99
R6176:Gne UTSW 4 44053019 intron probably benign
R6461:Gne UTSW 4 44060078 missense probably damaging 1.00
R6804:Gne UTSW 4 44060210 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGTTCTGAGTGAAATCCAC -3'
(R):5'- CTCAAGGGTTGATTGTCACCAG -3'

Sequencing Primer
(F):5'- GTGAAATCCACAGTGCCCGAG -3'
(R):5'- GTTGATTGTCACCAGAAAGGC -3'
Posted On2014-10-30