Incidental Mutation 'R2340:D930020B18Rik'
ID246712
Institutional Source Beutler Lab
Gene Symbol D930020B18Rik
Ensembl Gene ENSMUSG00000047642
Gene NameRIKEN cDNA D930020B18 gene
Synonyms
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location121641588-121693915 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 121654836 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 114 (K114E)
Ref Sequence ENSEMBL: ENSMUSP00000121976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120642] [ENSMUST00000132744] [ENSMUST00000140802] [ENSMUST00000142501]
Predicted Effect probably damaging
Transcript: ENSMUST00000120642
AA Change: K114E

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000113963
Gene: ENSMUSG00000047642
AA Change: K114E

DomainStartEndE-ValueType
Pfam:DUF4551 11 617 3.2e-237 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000132744
AA Change: K96E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118274
Gene: ENSMUSG00000047642
AA Change: K96E

DomainStartEndE-ValueType
Pfam:DUF4551 1 148 3.6e-66 PFAM
Pfam:DUF4551 142 443 6.1e-145 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000140802
AA Change: K114E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000121976
Gene: ENSMUSG00000047642
AA Change: K114E

DomainStartEndE-ValueType
Pfam:DUF4551 1 151 8.7e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142501
SMART Domains Protein: ENSMUSP00000118939
Gene: ENSMUSG00000047642

DomainStartEndE-ValueType
Pfam:DUF4551 1 182 1.3e-74 PFAM
Meta Mutation Damage Score 0.152 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in D930020B18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00479:D930020B18Rik APN 10 121685584 missense probably damaging 1.00
IGL01669:D930020B18Rik APN 10 121683961 missense probably benign 0.03
IGL01793:D930020B18Rik APN 10 121671831 missense probably damaging 1.00
IGL01907:D930020B18Rik APN 10 121642010 missense probably damaging 0.97
IGL01981:D930020B18Rik APN 10 121692414 missense probably damaging 0.98
IGL02545:D930020B18Rik APN 10 121689933 missense possibly damaging 0.87
IGL03024:D930020B18Rik APN 10 121685622 splice site probably benign
R0022:D930020B18Rik UTSW 10 121671770 missense probably damaging 0.97
R0023:D930020B18Rik UTSW 10 121689821 missense probably damaging 0.99
R1872:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
R4074:D930020B18Rik UTSW 10 121656218 intron probably benign
R4990:D930020B18Rik UTSW 10 121654761 missense probably damaging 1.00
R4990:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R4992:D930020B18Rik UTSW 10 121654761 missense probably damaging 1.00
R4992:D930020B18Rik UTSW 10 121654762 missense probably damaging 1.00
R5096:D930020B18Rik UTSW 10 121667804 missense probably benign 0.19
R5677:D930020B18Rik UTSW 10 121669201 missense probably benign 0.00
R6401:D930020B18Rik UTSW 10 121641857 missense possibly damaging 0.95
R6481:D930020B18Rik UTSW 10 121661148 critical splice donor site probably null
R7070:D930020B18Rik UTSW 10 121641974 missense probably damaging 1.00
X0021:D930020B18Rik UTSW 10 121641885 missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTAAGAGTCAGCTTGTCCTTAGTTG -3'
(R):5'- GGTTGGCCAGTGGAATAGTC -3'

Sequencing Primer
(F):5'- AGTCAGCTTGTCCTTAGTTGTGTGG -3'
(R):5'- AGAGGGACCTTGTCACAA -3'
Posted On2014-10-30