Incidental Mutation 'R2340:Rad51d'
ID246717
Institutional Source Beutler Lab
Gene Symbol Rad51d
Ensembl Gene ENSMUSG00000018841
Gene NameRAD51 paralog D
SynonymsR51H3, Rad51d
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2340 (G1)
Quality Score206
Status Validated
Chromosome11
Chromosomal Location82876434-82890614 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 82881821 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 206 (D206G)
Ref Sequence ENSEMBL: ENSMUSP00000122477 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018985] [ENSMUST00000021033] [ENSMUST00000092844] [ENSMUST00000100718] [ENSMUST00000135963] [ENSMUST00000146053]
Predicted Effect probably damaging
Transcript: ENSMUST00000018985
AA Change: D206G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018985
Gene: ENSMUSG00000018841
AA Change: D206G

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 2e-27 PDB
AAA 99 274 1.5e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021033
SMART Domains Protein: ENSMUSP00000021033
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 249 3e-15 PFAM
Pfam:AAA_25 69 200 2e-12 PFAM
Pfam:KaiC 82 148 1.4e-10 PFAM
Pfam:AAA_19 93 168 6.7e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000092844
AA Change: D161G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090520
Gene: ENSMUSG00000018841
AA Change: D161G

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 66 130 2.4e-7 PFAM
Pfam:KaiC 82 129 8e-8 PFAM
Pfam:Rad51 115 274 8.5e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100718
SMART Domains Protein: ENSMUSP00000098284
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 83 5e-30 PDB
SCOP:d1b22a_ 10 48 2e-4 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000135963
AA Change: D206G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122477
Gene: ENSMUSG00000018841
AA Change: D206G

DomainStartEndE-ValueType
low complexity region 28 40 N/A INTRINSIC
low complexity region 49 59 N/A INTRINSIC
Pfam:Rad51 64 219 7e-18 PFAM
Pfam:AAA_25 69 226 2.6e-15 PFAM
Pfam:KaiC 82 216 5.7e-12 PFAM
Pfam:AAA_19 93 168 1.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146053
SMART Domains Protein: ENSMUSP00000117401
Gene: ENSMUSG00000018841

DomainStartEndE-ValueType
PDB:2KZ3|A 1 48 1e-13 PDB
SCOP:d1b22a_ 10 48 7e-5 SMART
Meta Mutation Damage Score 0.42 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: This gene belongs to the Rad51 gene family whose products play a major role in homologous recombination and DNA repair. The encoded protein interacts with other proteins of this family, including Rad51b, Rad51c and Xrcc2, and plays an essential role in both DNA repair and telomere maintenance. In humans, germline mutations in this gene may be associated with predisposition to ovarian cancer. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for disruptions in this gene die as embryos before E11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Rad51d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Rad51d APN 11 82889746 missense probably damaging 1.00
IGL02755:Rad51d APN 11 82881632 missense probably benign 0.05
IGL03270:Rad51d APN 11 82881594 splice site probably benign
spew UTSW 11 82879333 missense probably damaging 0.99
R0179:Rad51d UTSW 11 82889998 missense possibly damaging 0.90
R1440:Rad51d UTSW 11 82890353 nonsense probably null
R1771:Rad51d UTSW 11 82883938 missense probably damaging 1.00
R2106:Rad51d UTSW 11 82879308 missense probably damaging 1.00
R5396:Rad51d UTSW 11 82890370 missense possibly damaging 0.90
R6917:Rad51d UTSW 11 82879333 missense probably damaging 0.99
R6941:Rad51d UTSW 11 82889797 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGCTGCATCATCAAGGCCAG -3'
(R):5'- GCTATAGCCGCAAACATTTTGTAC -3'

Sequencing Primer
(F):5'- CAGGCCTGGGGGAGGAG -3'
(R):5'- GGCTGTCCTGGAACTTCAAAGAC -3'
Posted On2014-10-30