Incidental Mutation 'R2340:Slc12a2'
ID246731
Institutional Source Beutler Lab
Gene Symbol Slc12a2
Ensembl Gene ENSMUSG00000024597
Gene Namesolute carrier family 12, member 2
SynonymsNkcc1, sy-ns, mBSC2, sodium/potassium/chloride cotransporters
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location57878678-57946821 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 57900050 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 400 (I400N)
Ref Sequence ENSEMBL: ENSMUSP00000111023 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115366]
Predicted Effect probably benign
Transcript: ENSMUST00000115366
AA Change: I400N

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000111023
Gene: ENSMUSG00000024597
AA Change: I400N

DomainStartEndE-ValueType
low complexity region 3 33 N/A INTRINSIC
low complexity region 43 59 N/A INTRINSIC
SCOP:d1gkub1 91 122 4e-3 SMART
low complexity region 141 162 N/A INTRINSIC
low complexity region 175 190 N/A INTRINSIC
Pfam:AA_permease_N 196 260 5.9e-29 PFAM
Pfam:AA_permease 284 787 4.1e-154 PFAM
Pfam:AA_permease_2 290 743 8.7e-22 PFAM
Pfam:SLC12 795 1206 2.7e-167 PFAM
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene mediates sodium and chloride transport and reabsorption. The encoded protein is a membrane protein and is important in maintaining proper ionic balance and cell volume. This protein is phosphorylated in response to DNA damage. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jan 2012]
PHENOTYPE: Homozygous mutants show variably severe deafness, head-shaking, circling, reduced endolymph secretion, male sterility, growth retardation, hypotension, reduced salivation, delayed ductal outgrowth of mammary epithelium and increased periweaning mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr1497 A G 19: 13,794,771 V280A probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Slc12a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Slc12a2 APN 18 57936405 missense probably damaging 1.00
IGL01099:Slc12a2 APN 18 57906020 nonsense probably null
IGL01896:Slc12a2 APN 18 57896308 missense probably benign 0.06
IGL02266:Slc12a2 APN 18 57912020 splice site probably benign
IGL02489:Slc12a2 APN 18 57912002 missense probably damaging 0.98
IGL02681:Slc12a2 APN 18 57879399 missense probably benign 0.25
IGL03068:Slc12a2 APN 18 57904335 splice site probably benign
IGL03076:Slc12a2 APN 18 57926397 splice site probably benign
IGL03086:Slc12a2 APN 18 57921784 missense probably benign 0.00
IGL03238:Slc12a2 APN 18 57914234 missense possibly damaging 0.85
frankie UTSW 18 57934963 missense possibly damaging 0.48
sugar UTSW 18 57899272 missense probably damaging 1.00
R0048:Slc12a2 UTSW 18 57915522 splice site probably benign
R0194:Slc12a2 UTSW 18 57930211 missense probably damaging 1.00
R0530:Slc12a2 UTSW 18 57919536 missense possibly damaging 0.76
R0959:Slc12a2 UTSW 18 57904378 missense probably damaging 1.00
R1014:Slc12a2 UTSW 18 57921810 missense probably benign 0.00
R1112:Slc12a2 UTSW 18 57937752 missense probably benign 0.01
R1544:Slc12a2 UTSW 18 57879302 missense probably benign 0.00
R1669:Slc12a2 UTSW 18 57904235 missense probably damaging 0.99
R1935:Slc12a2 UTSW 18 57904353 missense possibly damaging 0.95
R1951:Slc12a2 UTSW 18 57879395 missense possibly damaging 0.51
R1990:Slc12a2 UTSW 18 57910286 missense possibly damaging 0.61
R3971:Slc12a2 UTSW 18 57930196 missense possibly damaging 0.84
R4120:Slc12a2 UTSW 18 57899355 missense possibly damaging 0.95
R4223:Slc12a2 UTSW 18 57910256 missense probably damaging 1.00
R4541:Slc12a2 UTSW 18 57912965 intron probably null
R4678:Slc12a2 UTSW 18 57905960 nonsense probably null
R4931:Slc12a2 UTSW 18 57934963 missense possibly damaging 0.48
R5114:Slc12a2 UTSW 18 57899272 missense probably damaging 1.00
R5226:Slc12a2 UTSW 18 57879020 missense probably damaging 1.00
R5648:Slc12a2 UTSW 18 57896310 missense possibly damaging 0.83
R5726:Slc12a2 UTSW 18 57896354 missense probably benign 0.01
R5789:Slc12a2 UTSW 18 57912019 splice site probably null
R5868:Slc12a2 UTSW 18 57943996 missense probably damaging 1.00
R5921:Slc12a2 UTSW 18 57932523 missense probably benign 0.06
R6126:Slc12a2 UTSW 18 57944044 missense possibly damaging 0.94
R6310:Slc12a2 UTSW 18 57915506 missense probably damaging 0.99
R6598:Slc12a2 UTSW 18 57898073 missense probably benign 0.01
R6615:Slc12a2 UTSW 18 57898128 missense probably damaging 1.00
R6911:Slc12a2 UTSW 18 57919469 missense probably benign 0.05
R6957:Slc12a2 UTSW 18 57910272 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCCCTCTTGTATCGTGAAAGAC -3'
(R):5'- TGGGCTCAACTCTTAAGCACTC -3'

Sequencing Primer
(F):5'- CAGGCTAGCCTTGAAACTTTG -3'
(R):5'- GCATACAAATAGGAAAGCAGTGTTTC -3'
Posted On2014-10-30