Incidental Mutation 'R2340:Olfr1497'
ID246732
Institutional Source Beutler Lab
Gene Symbol Olfr1497
Ensembl Gene ENSMUSG00000044040
Gene Nameolfactory receptor 1497
SynonymsGA_x6K02T2RE5P-4127765-4126821, MOR212-1
MMRRC Submission 040326-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.153) question?
Stock #R2340 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location13794324-13798202 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13794771 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 280 (V280A)
Ref Sequence ENSEMBL: ENSMUSP00000149151 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061993] [ENSMUST00000217384]
Predicted Effect probably benign
Transcript: ENSMUST00000061993
AA Change: V280A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000053465
Gene: ENSMUSG00000044040
AA Change: V280A

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.3e-46 PFAM
Pfam:7TM_GPCR_Srsx 35 302 7e-7 PFAM
Pfam:7tm_1 41 290 5.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217384
AA Change: V280A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.042 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2700049A03Rik G T 12: 71,164,546 E685* probably null Het
2700049A03Rik A T 12: 71,164,547 E685V possibly damaging Het
Abca13 A T 11: 9,399,165 I3580F probably damaging Het
B3glct A G 5: 149,745,440 K280E probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Clu T C 14: 65,980,909 V406A probably damaging Het
D930020B18Rik A G 10: 121,654,836 K114E probably damaging Het
Dsg1c T A 18: 20,267,888 D149E probably damaging Het
Fam189a1 A G 7: 64,775,817 S176P probably benign Het
Fat2 A T 11: 55,270,096 D3269E possibly damaging Het
Frmd4a A G 2: 4,586,376 D69G probably damaging Het
Hacd1 G T 2: 14,035,887 P186T probably damaging Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Kif2c A G 4: 117,169,841 V320A probably damaging Het
Lypd2 T A 15: 74,734,254 I12L probably benign Het
Midn G T 10: 80,150,112 R12L possibly damaging Het
Olfr11 T C 13: 21,638,587 K312R probably benign Het
Olfr954 A G 9: 39,461,809 Y126C probably damaging Het
Pkhd1 A T 1: 20,200,855 V3158E probably damaging Het
Plxna2 C T 1: 194,749,317 S538F probably damaging Het
Rad51d T C 11: 82,881,821 D206G probably damaging Het
Rcan1 A G 16: 92,397,352 F58L probably damaging Het
Rnf145 T C 11: 44,531,378 I96T probably benign Het
Rnf216 A T 5: 143,080,334 F500I probably damaging Het
Rph3al T C 11: 75,833,432 T282A probably benign Het
Serpina11 T C 12: 103,984,743 R240G probably benign Het
Slc12a2 T A 18: 57,900,050 I400N probably benign Het
Slco1a4 C A 6: 141,841,377 C28F probably benign Het
Sned1 T A 1: 93,256,452 I134N probably damaging Het
Spock3 T A 8: 63,345,713 M253K probably damaging Het
Tmem184b T A 15: 79,378,532 M42L probably benign Het
Tnnt1 G A 7: 4,513,616 probably benign Het
Ttll5 T A 12: 85,892,148 S407T probably benign Het
Ugcg C T 4: 59,207,798 P46S probably benign Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Zfat T C 15: 68,101,541 E1117G probably damaging Het
Zfp606 A G 7: 12,493,089 E321G possibly damaging Het
Other mutations in Olfr1497
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Olfr1497 APN 19 13795329 missense possibly damaging 0.69
IGL02471:Olfr1497 APN 19 13795225 missense probably damaging 1.00
R0167:Olfr1497 UTSW 19 13795567 missense probably benign 0.03
R0602:Olfr1497 UTSW 19 13794662 unclassified probably null
R1448:Olfr1497 UTSW 19 13794776 nonsense probably null
R2211:Olfr1497 UTSW 19 13795369 missense probably benign
R2295:Olfr1497 UTSW 19 13794744 missense probably damaging 1.00
R3773:Olfr1497 UTSW 19 13795204 missense probably benign 0.00
R4596:Olfr1497 UTSW 19 13794900 missense probably damaging 1.00
R4676:Olfr1497 UTSW 19 13795474 missense possibly damaging 0.91
R4767:Olfr1497 UTSW 19 13795045 missense probably damaging 1.00
R4921:Olfr1497 UTSW 19 13795465 missense probably benign 0.03
R4930:Olfr1497 UTSW 19 13795551 missense probably benign 0.00
R5784:Olfr1497 UTSW 19 13795346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGTAAAGATGGGGTGTTTCAGTAC -3'
(R):5'- TGGCCATTATGCAAATCCGC -3'

Sequencing Primer
(F):5'- TTGAGTTCAAGAAAGCCTGCC -3'
(R):5'- ATTATGCAAATCCGCTCAGCTGG -3'
Posted On2014-10-30