Incidental Mutation 'R2341:Pole'
ID246746
Institutional Source Beutler Lab
Gene Symbol Pole
Ensembl Gene ENSMUSG00000007080
Gene Namepolymerase (DNA directed), epsilon
Synonymspol-epsilon
MMRRC Submission 040327-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2341 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location110286306-110337474 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 110330963 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 28 (I28F)
Ref Sequence ENSEMBL: ENSMUSP00000108100 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007296] [ENSMUST00000112481]
Predicted Effect probably benign
Transcript: ENSMUST00000007296
AA Change: I1904F

PolyPhen 2 Score 0.018 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000007296
Gene: ENSMUSG00000007080
AA Change: I1904F

DomainStartEndE-ValueType
POLBc 267 870 9.42e-97 SMART
Blast:POLBc 903 970 1e-28 BLAST
Blast:POLBc 1014 1073 2e-22 BLAST
Blast:POLBc 1195 1266 7e-21 BLAST
low complexity region 1275 1294 N/A INTRINSIC
Blast:DUF1744 1401 1430 2e-7 BLAST
DUF1744 1524 1924 1.9e-236 SMART
coiled coil region 1936 1963 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112481
AA Change: I28F

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000108100
Gene: ENSMUSG00000007080
AA Change: I28F

DomainStartEndE-ValueType
Pfam:DUF1744 13 48 2.7e-13 PFAM
coiled coil region 60 87 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000120365
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137099
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141506
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152495
Predicted Effect noncoding transcript
Transcript: ENSMUST00000157097
Meta Mutation Damage Score 0.154 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the catalytic subunit of DNA polymerase epsilon. The enzyme is involved in DNA repair and chromosomal DNA replication. Mutations in this gene have been associated with colorectal cancer 12 and facial dysmorphism, immunodeficiency, livedo, and short stature. [provided by RefSeq, Sep 2013]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit increased incidence of tumors and premature death. Mice homozygous for a transgenic gene disruption exhibit embryonic lethality at E7. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017D01Rik T A 19: 11,105,793 M88L probably benign Het
4933412E24Rik A G 15: 60,016,363 V76A possibly damaging Het
Aif1 G A 17: 35,172,151 P44L probably benign Het
Anapc4 T C 5: 52,841,937 probably benign Het
Anxa4 A G 6: 86,743,153 S144P probably benign Het
Bcr A G 10: 75,131,112 E517G probably damaging Het
Ccdc57 T C 11: 120,860,523 E907G probably benign Het
Chd6 TG T 2: 160,965,759 probably null Het
Dock6 A G 9: 21,839,486 probably benign Het
Dock8 A G 19: 25,200,393 K2031E probably damaging Het
Gm5444 T C 13: 4,834,345 noncoding transcript Het
Hlx G T 1: 184,731,987 A52D probably damaging Het
Ifna16 A G 4: 88,676,328 S177P probably damaging Het
Ino80d T C 1: 63,065,826 N364D possibly damaging Het
Ltbp2 T C 12: 84,809,163 T769A probably benign Het
Mug1 T C 6: 121,884,629 V1350A probably benign Het
Nedd9 A G 13: 41,316,511 S389P probably damaging Het
Olfr1098 T C 2: 86,922,638 K298R possibly damaging Het
Olfr1122 A T 2: 87,387,740 I12F probably benign Het
Olfr1201 A G 2: 88,794,645 N88D probably benign Het
Prkce C A 17: 86,474,442 P180T probably damaging Het
Ralgapa1 T C 12: 55,677,124 H1995R possibly damaging Het
Rnf144b A G 13: 47,220,500 K58E probably benign Het
Rnf43 A G 11: 87,732,025 R651G probably damaging Het
Scel A T 14: 103,608,170 L580F possibly damaging Het
Scn4b G A 9: 45,147,829 V133M probably damaging Het
Sipa1l3 T C 7: 29,377,635 N904S probably damaging Het
Sun5 A G 2: 153,867,502 probably benign Het
Tanc2 T C 11: 105,835,051 V347A probably benign Het
Tmem245 T C 4: 56,937,957 Y197C probably damaging Het
Usp30 C T 5: 114,111,180 R182* probably null Het
Vmn2r112 T A 17: 22,603,115 V258E probably damaging Het
Vps35 T C 8: 85,274,814 probably benign Het
Xkr7 G A 2: 153,054,398 V391M possibly damaging Het
Ythdf3 A T 3: 16,203,215 probably benign Het
Zfp110 T C 7: 12,849,186 V587A probably benign Het
Other mutations in Pole
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00418:Pole APN 5 110303565 splice site probably benign
IGL00475:Pole APN 5 110291096 nonsense probably null
IGL00837:Pole APN 5 110302009 missense possibly damaging 0.91
IGL00976:Pole APN 5 110323572 missense probably benign 0.00
IGL01081:Pole APN 5 110337240 missense possibly damaging 0.92
IGL01503:Pole APN 5 110303884 missense probably damaging 1.00
IGL01640:Pole APN 5 110298266 missense probably null 0.08
IGL01987:Pole APN 5 110337232 missense probably benign 0.01
IGL02429:Pole APN 5 110299800 missense probably benign
IGL02733:Pole APN 5 110312728 splice site probably benign
IGL03102:Pole APN 5 110297073 missense probably damaging 1.00
IGL03157:Pole APN 5 110293753 missense probably benign
IGL03186:Pole APN 5 110299920 critical splice donor site probably null
IGL03271:Pole APN 5 110318319 missense probably benign
IGL03351:Pole APN 5 110301998 splice site probably benign
IGL03408:Pole APN 5 110294560 missense probably damaging 1.00
IGL03410:Pole APN 5 110324559 missense probably benign
ANU74:Pole UTSW 5 110289370 missense probably benign 0.44
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0053:Pole UTSW 5 110293340 missense probably damaging 1.00
R0124:Pole UTSW 5 110303992 missense probably damaging 0.96
R0145:Pole UTSW 5 110324425 missense probably damaging 0.99
R0523:Pole UTSW 5 110303593 missense probably damaging 0.96
R0590:Pole UTSW 5 110317926 missense probably benign
R0625:Pole UTSW 5 110325550 missense possibly damaging 0.50
R0707:Pole UTSW 5 110298988 missense probably damaging 1.00
R1160:Pole UTSW 5 110295253 missense possibly damaging 0.85
R1320:Pole UTSW 5 110309129 frame shift probably null
R1384:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1626:Pole UTSW 5 110293369 missense probably benign 0.25
R1643:Pole UTSW 5 110317845 missense probably damaging 1.00
R1655:Pole UTSW 5 110335922 missense probably damaging 1.00
R1668:Pole UTSW 5 110297369 missense probably damaging 1.00
R1783:Pole UTSW 5 110297430 missense probably damaging 1.00
R1843:Pole UTSW 5 110330835 critical splice donor site probably null
R1853:Pole UTSW 5 110306853 missense possibly damaging 0.95
R1867:Pole UTSW 5 110334197 missense probably benign 0.08
R1874:Pole UTSW 5 110323664 missense possibly damaging 0.81
R1891:Pole UTSW 5 110332542 missense probably damaging 1.00
R1928:Pole UTSW 5 110327778 missense probably benign
R2073:Pole UTSW 5 110325551 missense probably damaging 0.99
R2448:Pole UTSW 5 110297092 missense probably damaging 1.00
R2504:Pole UTSW 5 110290502 splice site probably null
R3053:Pole UTSW 5 110289795 missense probably damaging 1.00
R3892:Pole UTSW 5 110336439 missense probably damaging 1.00
R3964:Pole UTSW 5 110312782 missense probably damaging 1.00
R3965:Pole UTSW 5 110312782 missense probably damaging 1.00
R4374:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4376:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4377:Pole UTSW 5 110337205 missense possibly damaging 0.89
R4520:Pole UTSW 5 110297924 missense probably damaging 1.00
R4670:Pole UTSW 5 110306387 missense probably benign 0.01
R4778:Pole UTSW 5 110330832 missense probably benign 0.00
R4887:Pole UTSW 5 110324753 missense probably damaging 0.99
R4898:Pole UTSW 5 110290224 critical splice acceptor site probably null
R5184:Pole UTSW 5 110294934 missense possibly damaging 0.91
R5359:Pole UTSW 5 110332488 missense probably benign 0.03
R5483:Pole UTSW 5 110294568 missense probably damaging 1.00
R5529:Pole UTSW 5 110332466 missense probably benign 0.20
R5576:Pole UTSW 5 110312065 nonsense probably null
R5817:Pole UTSW 5 110312972 missense probably damaging 1.00
R5877:Pole UTSW 5 110332463 missense probably benign
R5956:Pole UTSW 5 110337287 unclassified probably benign
R5990:Pole UTSW 5 110302144 missense probably damaging 1.00
R6019:Pole UTSW 5 110324514 missense probably benign 0.01
R6019:Pole UTSW 5 110324515 missense probably benign 0.01
R6093:Pole UTSW 5 110312090 missense probably benign 0.01
R6376:Pole UTSW 5 110336374 missense probably damaging 0.99
R6494:Pole UTSW 5 110324722 missense possibly damaging 0.86
R6535:Pole UTSW 5 110324807 missense probably damaging 1.00
R6723:Pole UTSW 5 110323616 missense probably benign 0.11
R6757:Pole UTSW 5 110303610 missense probably damaging 1.00
R6930:Pole UTSW 5 110293290 missense probably benign 0.01
R6988:Pole UTSW 5 110329583 missense probably damaging 0.97
X0064:Pole UTSW 5 110317904 nonsense probably null
Y5377:Pole UTSW 5 110294891 critical splice acceptor site probably null
Y5380:Pole UTSW 5 110294891 critical splice acceptor site probably null
Z1088:Pole UTSW 5 110327865 missense possibly damaging 0.66
Predicted Primers PCR Primer
(F):5'- GGCAGTTGTTTACAGGCAGC -3'
(R):5'- CACTAGGGTTAATGGTGTACTCC -3'

Sequencing Primer
(F):5'- CAGCTCCTTCAGTATGCTAGGAAG -3'
(R):5'- GGTGTACTCCTAACTTTTCCTGTAAG -3'
Posted On2014-10-30