Incidental Mutation 'R2342:Arhgef28'
ID 246797
Institutional Source Beutler Lab
Gene Symbol Arhgef28
Ensembl Gene ENSMUSG00000021662
Gene Name Rho guanine nucleotide exchange factor 28
Synonyms Rgnef, 9230110L08Rik, Rho specific exchange factor, RhoGEF, RIP2, D13Bwg1089e, p190RhoGEF
MMRRC Submission 040328-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2342 (G1)
Quality Score 225
Status Validated
Chromosome 13
Chromosomal Location 98035977-98342947 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 98130537 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Lysine at position 434 (E434K)
Ref Sequence ENSEMBL: ENSMUSP00000153000 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109426] [ENSMUST00000223849] [ENSMUST00000225884]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000109426
AA Change: E434K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000105053
Gene: ENSMUSG00000021662
AA Change: E434K

DomainStartEndE-ValueType
low complexity region 530 568 N/A INTRINSIC
low complexity region 634 650 N/A INTRINSIC
C1 652 698 1.65e-11 SMART
RhoGEF 850 1040 1.11e-65 SMART
PH 1084 1187 1.08e-9 SMART
low complexity region 1267 1281 N/A INTRINSIC
coiled coil region 1469 1522 N/A INTRINSIC
low complexity region 1647 1663 N/A INTRINSIC
low complexity region 1682 1693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000223849
AA Change: E434K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224926
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225663
Predicted Effect probably benign
Transcript: ENSMUST00000225884
AA Change: E434K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.1244 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 100% (39/39)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Rho guanine nucleotide exchange factor family. The encoded protein interacts with low molecular weight neurofilament mRNA and may be involved in the formation of amyotrophic lateral sclerosis neurofilament aggregates. Alternate splicing results in multiple transcript variants.[provided by RefSeq, Apr 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are born at lower than expected Mendelian ratios and exhibit a reduction in overall size that becomes negligible by 8 weeks of age. Mouse embryonic fibroblasts display defects in cell migration and focal adhesion formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Babam1 T A 8: 71,855,515 (GRCm39) M236K probably benign Het
Camk1 T C 6: 113,318,942 (GRCm39) probably benign Het
Chd8 A C 14: 52,442,674 (GRCm39) N625K probably benign Het
Dcaf8 A G 1: 172,013,928 (GRCm39) H373R possibly damaging Het
Dscam G A 16: 96,420,702 (GRCm39) T1728M probably damaging Het
Elf1 T C 14: 79,802,896 (GRCm39) probably benign Het
Epha2 C T 4: 141,050,842 (GRCm39) A866V probably benign Het
Frmd6 C A 12: 70,930,592 (GRCm39) Y237* probably null Het
Glg1 A T 8: 111,914,439 (GRCm39) C448* probably null Het
Gm4787 G T 12: 81,425,532 (GRCm39) R209S possibly damaging Het
Hhipl1 T C 12: 108,284,721 (GRCm39) L358P probably damaging Het
Hmgxb3 G A 18: 61,296,063 (GRCm39) T315I possibly damaging Het
Irak2 C A 6: 113,670,632 (GRCm39) T539K probably benign Het
Lrp1b C A 2: 40,809,208 (GRCm39) G2568C possibly damaging Het
Meis1 C T 11: 18,831,647 (GRCm39) A464T probably damaging Het
Or10g1b C A 14: 52,627,322 (GRCm39) A303S possibly damaging Het
Or6a2 T C 7: 106,600,116 (GRCm39) D317G probably benign Het
Orc4 A G 2: 48,817,152 (GRCm39) S179P probably damaging Het
Plxna2 C T 1: 194,431,625 (GRCm39) S538F probably damaging Het
Pnliprp1 A G 19: 58,729,691 (GRCm39) probably benign Het
Prpf40b T A 15: 99,204,049 (GRCm39) V174D probably damaging Het
Rnf169 T C 7: 99,574,652 (GRCm39) K648E possibly damaging Het
Rtf1 A G 2: 119,542,598 (GRCm39) T301A probably benign Het
Sdccag8 T C 1: 176,747,207 (GRCm39) V528A probably benign Het
Sgsh A G 11: 119,238,540 (GRCm39) V308A probably benign Het
Shmt2 A G 10: 127,354,680 (GRCm39) V335A possibly damaging Het
Skint6 T A 4: 113,034,180 (GRCm39) T316S probably benign Het
Tbl2 G A 5: 135,187,607 (GRCm39) R288Q possibly damaging Het
Ttc3 C T 16: 94,232,857 (GRCm39) P1003L probably damaging Het
Usp34 A G 11: 23,353,599 (GRCm39) K1469E possibly damaging Het
Virma T C 4: 11,501,316 (GRCm39) Y92H probably damaging Het
Vmn2r112 T A 17: 22,822,096 (GRCm39) V258E probably damaging Het
Wnt16 A G 6: 22,288,923 (GRCm39) E80G probably damaging Het
Zbtb10 C T 3: 9,330,255 (GRCm39) P538S possibly damaging Het
Zup1 G A 10: 33,804,113 (GRCm39) H454Y probably damaging Het
Other mutations in Arhgef28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00426:Arhgef28 APN 13 98,124,785 (GRCm39) missense probably benign 0.15
IGL00945:Arhgef28 APN 13 98,103,907 (GRCm39) missense possibly damaging 0.88
IGL01099:Arhgef28 APN 13 98,090,480 (GRCm39) splice site probably benign
IGL01328:Arhgef28 APN 13 98,106,831 (GRCm39) missense probably damaging 1.00
IGL01396:Arhgef28 APN 13 98,090,401 (GRCm39) missense probably damaging 0.99
IGL02067:Arhgef28 APN 13 98,213,825 (GRCm39) missense probably damaging 1.00
IGL02147:Arhgef28 APN 13 98,097,822 (GRCm39) missense probably damaging 1.00
IGL02285:Arhgef28 APN 13 98,187,536 (GRCm39) missense possibly damaging 0.85
IGL02439:Arhgef28 APN 13 98,067,647 (GRCm39) missense possibly damaging 0.75
IGL02499:Arhgef28 APN 13 98,090,291 (GRCm39) missense possibly damaging 0.87
IGL02532:Arhgef28 APN 13 98,166,391 (GRCm39) missense probably damaging 0.99
IGL02634:Arhgef28 APN 13 98,187,566 (GRCm39) missense probably benign 0.00
IGL02902:Arhgef28 APN 13 98,083,383 (GRCm39) missense probably damaging 1.00
IGL03067:Arhgef28 APN 13 98,124,794 (GRCm39) missense probably benign 0.00
IGL03081:Arhgef28 APN 13 98,165,881 (GRCm39) splice site probably benign
IGL03106:Arhgef28 APN 13 98,094,301 (GRCm39) missense probably damaging 1.00
IGL03195:Arhgef28 APN 13 98,088,071 (GRCm39) splice site probably null
IGL03325:Arhgef28 APN 13 98,036,324 (GRCm39) missense probably benign 0.03
H8786:Arhgef28 UTSW 13 98,083,461 (GRCm39) missense probably damaging 1.00
R0027:Arhgef28 UTSW 13 98,082,204 (GRCm39) missense possibly damaging 0.94
R0027:Arhgef28 UTSW 13 98,082,204 (GRCm39) missense possibly damaging 0.94
R0062:Arhgef28 UTSW 13 98,093,150 (GRCm39) missense possibly damaging 0.56
R0062:Arhgef28 UTSW 13 98,093,150 (GRCm39) missense possibly damaging 0.56
R0090:Arhgef28 UTSW 13 98,211,618 (GRCm39) missense probably damaging 0.99
R0096:Arhgef28 UTSW 13 98,067,762 (GRCm39) missense probably damaging 1.00
R0096:Arhgef28 UTSW 13 98,067,762 (GRCm39) missense probably damaging 1.00
R0537:Arhgef28 UTSW 13 98,094,224 (GRCm39) missense probably damaging 1.00
R0617:Arhgef28 UTSW 13 98,106,863 (GRCm39) missense probably benign 0.21
R0711:Arhgef28 UTSW 13 98,067,762 (GRCm39) missense probably damaging 1.00
R0723:Arhgef28 UTSW 13 98,075,987 (GRCm39) missense probably benign 0.16
R0790:Arhgef28 UTSW 13 98,117,914 (GRCm39) missense possibly damaging 0.51
R1240:Arhgef28 UTSW 13 98,066,000 (GRCm39) missense probably benign 0.00
R1365:Arhgef28 UTSW 13 98,211,632 (GRCm39) missense probably damaging 1.00
R1456:Arhgef28 UTSW 13 98,211,510 (GRCm39) missense probably benign 0.01
R1490:Arhgef28 UTSW 13 98,114,952 (GRCm39) missense probably damaging 1.00
R1496:Arhgef28 UTSW 13 98,102,054 (GRCm39) missense possibly damaging 0.93
R1660:Arhgef28 UTSW 13 98,117,884 (GRCm39) missense probably benign 0.05
R1671:Arhgef28 UTSW 13 98,067,542 (GRCm39) missense possibly damaging 0.95
R1747:Arhgef28 UTSW 13 98,073,332 (GRCm39) missense probably damaging 1.00
R1792:Arhgef28 UTSW 13 98,067,694 (GRCm39) missense probably benign 0.03
R1864:Arhgef28 UTSW 13 98,130,640 (GRCm39) missense probably benign 0.00
R1887:Arhgef28 UTSW 13 98,282,081 (GRCm39) missense probably damaging 0.97
R1924:Arhgef28 UTSW 13 98,073,324 (GRCm39) splice site probably benign
R1987:Arhgef28 UTSW 13 98,103,604 (GRCm39) missense probably benign
R2215:Arhgef28 UTSW 13 98,187,529 (GRCm39) missense possibly damaging 0.78
R2495:Arhgef28 UTSW 13 98,165,881 (GRCm39) splice site probably benign
R3897:Arhgef28 UTSW 13 98,093,084 (GRCm39) missense probably damaging 1.00
R3922:Arhgef28 UTSW 13 98,130,452 (GRCm39) missense possibly damaging 0.92
R4063:Arhgef28 UTSW 13 98,130,575 (GRCm39) missense probably benign 0.16
R4086:Arhgef28 UTSW 13 98,103,712 (GRCm39) missense probably damaging 0.98
R4543:Arhgef28 UTSW 13 98,211,508 (GRCm39) missense probably benign 0.00
R4730:Arhgef28 UTSW 13 98,114,650 (GRCm39) missense probably benign 0.00
R4735:Arhgef28 UTSW 13 98,036,237 (GRCm39) missense probably damaging 1.00
R4953:Arhgef28 UTSW 13 98,066,062 (GRCm39) missense possibly damaging 0.51
R5069:Arhgef28 UTSW 13 98,211,714 (GRCm39) missense probably damaging 0.96
R5558:Arhgef28 UTSW 13 98,097,968 (GRCm39) missense probably damaging 1.00
R5573:Arhgef28 UTSW 13 98,065,999 (GRCm39) missense probably benign 0.01
R5594:Arhgef28 UTSW 13 98,076,000 (GRCm39) missense probably benign 0.00
R5937:Arhgef28 UTSW 13 98,076,051 (GRCm39) missense probably benign 0.00
R5987:Arhgef28 UTSW 13 98,073,368 (GRCm39) nonsense probably null
R6015:Arhgef28 UTSW 13 98,211,530 (GRCm39) missense possibly damaging 0.73
R6193:Arhgef28 UTSW 13 98,121,888 (GRCm39) missense probably damaging 1.00
R6209:Arhgef28 UTSW 13 98,065,917 (GRCm39) critical splice donor site probably null
R6306:Arhgef28 UTSW 13 98,121,896 (GRCm39) missense probably damaging 1.00
R6393:Arhgef28 UTSW 13 98,130,527 (GRCm39) missense possibly damaging 0.64
R6562:Arhgef28 UTSW 13 98,124,647 (GRCm39) critical splice donor site probably null
R6646:Arhgef28 UTSW 13 98,076,002 (GRCm39) missense probably benign 0.09
R6655:Arhgef28 UTSW 13 98,036,163 (GRCm39) missense probably damaging 1.00
R6707:Arhgef28 UTSW 13 98,211,624 (GRCm39) missense possibly damaging 0.80
R6707:Arhgef28 UTSW 13 98,073,224 (GRCm39) missense probably damaging 0.96
R6751:Arhgef28 UTSW 13 98,211,755 (GRCm39) missense probably damaging 0.97
R6940:Arhgef28 UTSW 13 98,102,038 (GRCm39) missense possibly damaging 0.58
R7018:Arhgef28 UTSW 13 98,101,943 (GRCm39) missense probably damaging 1.00
R7030:Arhgef28 UTSW 13 98,124,769 (GRCm39) missense possibly damaging 0.88
R7120:Arhgef28 UTSW 13 98,081,047 (GRCm39) missense probably damaging 1.00
R7266:Arhgef28 UTSW 13 98,101,960 (GRCm39) missense probably benign
R7353:Arhgef28 UTSW 13 98,211,710 (GRCm39) missense probably damaging 1.00
R7368:Arhgef28 UTSW 13 98,133,370 (GRCm39) missense probably benign 0.34
R7491:Arhgef28 UTSW 13 98,081,194 (GRCm39) missense probably benign 0.03
R7500:Arhgef28 UTSW 13 98,115,003 (GRCm39) missense probably benign 0.00
R7653:Arhgef28 UTSW 13 98,105,821 (GRCm39) missense probably benign 0.04
R7813:Arhgef28 UTSW 13 98,082,189 (GRCm39) missense possibly damaging 0.48
R7989:Arhgef28 UTSW 13 98,036,243 (GRCm39) missense probably benign
R8064:Arhgef28 UTSW 13 98,115,002 (GRCm39) missense probably benign 0.13
R8221:Arhgef28 UTSW 13 98,282,064 (GRCm39) missense probably benign 0.00
R8293:Arhgef28 UTSW 13 98,079,029 (GRCm39) missense probably benign 0.00
R8328:Arhgef28 UTSW 13 98,187,517 (GRCm39) missense possibly damaging 0.88
R8348:Arhgef28 UTSW 13 98,190,375 (GRCm39) missense possibly damaging 0.50
R8432:Arhgef28 UTSW 13 98,088,091 (GRCm39) missense probably benign 0.29
R8843:Arhgef28 UTSW 13 98,130,557 (GRCm39) missense probably benign
R8859:Arhgef28 UTSW 13 98,082,210 (GRCm39) missense probably damaging 1.00
R8954:Arhgef28 UTSW 13 98,066,141 (GRCm39) missense probably benign 0.03
R8987:Arhgef28 UTSW 13 98,190,472 (GRCm39) missense possibly damaging 0.87
R9253:Arhgef28 UTSW 13 98,124,779 (GRCm39) missense probably benign 0.09
R9351:Arhgef28 UTSW 13 98,130,576 (GRCm39) missense probably benign 0.11
R9381:Arhgef28 UTSW 13 98,036,269 (GRCm39) missense possibly damaging 0.60
R9395:Arhgef28 UTSW 13 98,103,692 (GRCm39) frame shift probably null
R9466:Arhgef28 UTSW 13 98,124,825 (GRCm39) missense
R9529:Arhgef28 UTSW 13 98,213,773 (GRCm39) missense probably damaging 1.00
R9641:Arhgef28 UTSW 13 98,078,983 (GRCm39) missense probably benign 0.00
R9662:Arhgef28 UTSW 13 98,065,969 (GRCm39) missense probably benign 0.20
R9744:Arhgef28 UTSW 13 98,094,261 (GRCm39) missense probably damaging 1.00
R9776:Arhgef28 UTSW 13 98,133,415 (GRCm39) missense probably benign 0.19
Z1088:Arhgef28 UTSW 13 98,082,199 (GRCm39) missense probably damaging 1.00
Z1177:Arhgef28 UTSW 13 98,036,264 (GRCm39) missense probably benign 0.43
Predicted Primers PCR Primer
(F):5'- GGGGCAACGTTTTGATATAGAC -3'
(R):5'- ATTCTCTTCCAACGTCCAGG -3'

Sequencing Primer
(F):5'- GGGGCAGGTTTTAAAATGAAACTTTC -3'
(R):5'- CCAGGTTGGCGATTTGGATATCAAC -3'
Posted On 2014-10-30