Incidental Mutation 'R2354:Shox2'
ID246817
Institutional Source Beutler Lab
Gene Symbol Shox2
Ensembl Gene ENSMUSG00000027833
Gene Nameshort stature homeobox 2
SynonymsPrx3, 6330543G17Rik, Og12x
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2354 (G1)
Quality Score107
Status Validated
Chromosome3
Chromosomal Location66971727-66981771 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66981489 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 23 (I23T)
Ref Sequence ENSEMBL: ENSMUSP00000029422 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029422] [ENSMUST00000046542] [ENSMUST00000065047] [ENSMUST00000065074] [ENSMUST00000160504] [ENSMUST00000161726] [ENSMUST00000162036] [ENSMUST00000162060] [ENSMUST00000162362] [ENSMUST00000162439] [ENSMUST00000162693] [ENSMUST00000195261]
Predicted Effect possibly damaging
Transcript: ENSMUST00000029422
AA Change: I23T

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000029422
Gene: ENSMUSG00000027833
AA Change: I23T

DomainStartEndE-ValueType
low complexity region 57 90 N/A INTRINSIC
HOX 140 202 1.8e-28 SMART
low complexity region 258 273 N/A INTRINSIC
Pfam:OAR 310 327 3.3e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000046542
SMART Domains Protein: ENSMUSP00000047077
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 116 N/A INTRINSIC
coiled coil region 138 191 N/A INTRINSIC
low complexity region 223 236 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065047
SMART Domains Protein: ENSMUSP00000066967
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 109 N/A INTRINSIC
coiled coil region 122 175 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000065074
SMART Domains Protein: ENSMUSP00000066797
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160504
SMART Domains Protein: ENSMUSP00000124925
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161726
SMART Domains Protein: ENSMUSP00000124347
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162036
SMART Domains Protein: ENSMUSP00000125468
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 95 N/A INTRINSIC
low complexity region 98 159 N/A INTRINSIC
coiled coil region 180 233 N/A INTRINSIC
low complexity region 265 278 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162060
SMART Domains Protein: ENSMUSP00000125031
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162098
SMART Domains Protein: ENSMUSP00000123838
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
low complexity region 1 11 N/A INTRINSIC
HOX 61 123 1.8e-28 SMART
low complexity region 167 182 N/A INTRINSIC
Pfam:OAR 219 236 1e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162362
SMART Domains Protein: ENSMUSP00000123699
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 59 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162439
SMART Domains Protein: ENSMUSP00000124924
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 1.8e-28 SMART
low complexity region 117 132 N/A INTRINSIC
Pfam:OAR 167 187 9.7e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162620
Predicted Effect probably benign
Transcript: ENSMUST00000162693
SMART Domains Protein: ENSMUSP00000125547
Gene: ENSMUSG00000034544

DomainStartEndE-ValueType
low complexity region 3 88 N/A INTRINSIC
low complexity region 96 157 N/A INTRINSIC
coiled coil region 178 231 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000195261
SMART Domains Protein: ENSMUSP00000141625
Gene: ENSMUSG00000027833

DomainStartEndE-ValueType
HOX 11 73 9e-31 SMART
Meta Mutation Damage Score 0.318 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the homeobox family of genes that encode proteins containing a 60-amino acid residue motif that represents a DNA binding domain. Homeobox genes have been characterized extensively as transcriptional regulators involved in pattern formation in both invertebrate and vertebrate species. Several human genetic disorders are caused by aberrations in human homeobox genes. This locus represents a pseudoautosomal homeobox gene that is thought to be responsible for idiopathic short stature, and it is implicated in the short stature phenotype of Turner syndrome patients. This gene is considered to be a candidate gene for Cornelia de Lange syndrome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2009]
PHENOTYPE: Homozygous null mice display incomplete penetrance of embryonic lethality during organogenesis and incomplete clefting of the anterior part of the palate. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Sstr5 A G 17: 25,491,901 I118T probably benign Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Shox2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00334:Shox2 APN 3 66981441 missense possibly damaging 0.49
IGL00813:Shox2 APN 3 66975444 missense probably damaging 1.00
IGL01534:Shox2 APN 3 66978363 missense probably benign 0.01
IGL01583:Shox2 APN 3 66973771 unclassified probably benign
R0306:Shox2 UTSW 3 66973834 missense probably damaging 0.98
R0374:Shox2 UTSW 3 66973851 missense probably damaging 0.98
R0625:Shox2 UTSW 3 66981544 critical splice donor site probably null
R0774:Shox2 UTSW 3 66973811 missense probably damaging 1.00
R1102:Shox2 UTSW 3 66978295 missense probably damaging 1.00
R1192:Shox2 UTSW 3 66973910 nonsense probably null
R2518:Shox2 UTSW 3 66978359 missense possibly damaging 0.83
R4163:Shox2 UTSW 3 66973771 unclassified probably benign
R4976:Shox2 UTSW 3 66973675 unclassified probably benign
R5423:Shox2 UTSW 3 66973754 unclassified probably benign
R5493:Shox2 UTSW 3 66981463 missense probably damaging 1.00
R6528:Shox2 UTSW 3 66981285 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ATCCCGGTATCTCCCAAAGC -3'
(R):5'- CTGCCCCATTGATGTGTTATTATTG -3'

Sequencing Primer
(F):5'- ATGTCCAGCTCCCGGAC -3'
(R):5'- TTATTGGGGGGGCTGGAGCAGTAAA -3'
Posted On2014-10-30