Incidental Mutation 'R2354:Cdh15'
ID 246831
Institutional Source Beutler Lab
Gene Symbol Cdh15
Ensembl Gene ENSMUSG00000031962
Gene Name cadherin 15
Synonyms M cadherin, Mcad, Cdh14
MMRRC Submission 040336-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2354 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 123575113-123594136 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 123588763 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Glutamine at position 279 (R279Q)
Ref Sequence ENSEMBL: ENSMUSP00000034443 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034443] [ENSMUST00000127664]
AlphaFold P33146
Predicted Effect probably damaging
Transcript: ENSMUST00000034443
AA Change: R279Q

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000034443
Gene: ENSMUSG00000031962
AA Change: R279Q

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CA 64 149 5.95e-18 SMART
CA 173 257 3.09e-25 SMART
CA 280 373 2.5e-11 SMART
CA 396 480 3.45e-14 SMART
Pfam:Cadherin 486 579 5.2e-9 PFAM
transmembrane domain 603 625 N/A INTRINSIC
Pfam:Cadherin_C 633 783 6.7e-50 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127664
SMART Domains Protein: ENSMUSP00000118564
Gene: ENSMUSG00000092329

DomainStartEndE-ValueType
Pfam:Glycos_transf_2 104 287 7.4e-31 PFAM
Pfam:Glyco_transf_7C 261 331 4.9e-8 PFAM
RICIN 406 531 9.28e-27 SMART
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: This gene encodes a member of the cadherin family of calcium-dependent glycoproteins that mediate cell adhesion and regulate many morphogenetic events during development. The encoded preproprotein is further processed to generate a mature protein. Based on the expression of this gene in skeletal muscle, satellite cells and cerebellum, it was postulated that the encoded protein may be important for muscle development and regeneration. Mice lacking the encoded protein appear normal and display no discernible defects in skeletal musculature. Multiple distinct genes of the cadherin family, including this gene, are found on chromosome 8. [provided by RefSeq, Nov 2015]
PHENOTYPE: Homozygous null mice are viable, fertile, and show no apparent defects in the development, maintenance, or regeneration of skeletal muscle or in the cerebellum. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3b2 C T 7: 81,123,598 (GRCm39) probably benign Het
B4galt3 C A 1: 171,101,613 (GRCm39) H196N probably damaging Het
Bpifb9b C T 2: 154,153,662 (GRCm39) L243F probably benign Het
Cd226 A T 18: 89,265,107 (GRCm39) probably null Het
Cep295 A G 9: 15,246,080 (GRCm39) I792T possibly damaging Het
Cfap46 T C 7: 139,240,962 (GRCm39) Y469C probably damaging Het
Col9a2 C G 4: 120,911,455 (GRCm39) R599G probably damaging Het
D630045J12Rik G A 6: 38,135,026 (GRCm39) P1385S possibly damaging Het
Ddb1 A T 19: 10,584,337 (GRCm39) M64L probably benign Het
Dyrk1b G A 7: 27,884,797 (GRCm39) R404Q possibly damaging Het
Gal3st2b A G 1: 93,867,508 (GRCm39) T52A probably damaging Het
Galk2 C A 2: 125,773,193 (GRCm39) S208R probably benign Het
Hap1 A T 11: 100,245,541 (GRCm39) I141N probably damaging Het
Hif3a T C 7: 16,775,030 (GRCm39) S523G probably damaging Het
Kirrel1 C T 3: 86,995,792 (GRCm39) V381I probably damaging Het
Lmbrd1 T C 1: 24,724,622 (GRCm39) S69P probably damaging Het
Lrriq1 C T 10: 103,025,848 (GRCm39) V925M probably damaging Het
Mmp16 A G 4: 18,112,001 (GRCm39) Y459C probably damaging Het
Mtr A G 13: 12,203,043 (GRCm39) probably benign Het
Nadk2 T A 15: 9,085,862 (GRCm39) I167N probably damaging Het
Neo1 A G 9: 58,892,917 (GRCm39) F242L probably benign Het
Pitpnm2 A T 5: 124,260,982 (GRCm39) V1010E probably damaging Het
Prp2rt G A 13: 97,235,309 (GRCm39) T146I probably damaging Het
Semp2l2b G T 10: 21,943,155 (GRCm39) T275K probably benign Het
Shox2 A G 3: 66,888,822 (GRCm39) I23T possibly damaging Het
Slc5a12 T C 2: 110,439,777 (GRCm39) V141A probably damaging Het
Sstr5 A G 17: 25,710,875 (GRCm39) I118T probably benign Het
Taar4 A G 10: 23,836,912 (GRCm39) N174S probably damaging Het
Tpcn2 C A 7: 144,810,955 (GRCm39) G581W probably damaging Het
Umod C T 7: 119,065,416 (GRCm39) V538M probably damaging Het
Vmn2r44 T G 7: 8,373,639 (GRCm39) S517R probably damaging Het
Zc3h12d G T 10: 7,743,702 (GRCm39) V491L probably benign Het
Zfp358 A T 8: 3,545,454 (GRCm39) H12L possibly damaging Het
Zkscan7 A G 9: 122,723,892 (GRCm39) D287G probably benign Het
Other mutations in Cdh15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01329:Cdh15 APN 8 123,592,062 (GRCm39) intron probably benign
IGL01958:Cdh15 APN 8 123,586,089 (GRCm39) missense probably damaging 1.00
IGL02588:Cdh15 APN 8 123,583,291 (GRCm39) nonsense probably null
IGL02793:Cdh15 APN 8 123,587,721 (GRCm39) missense probably damaging 1.00
IGL02947:Cdh15 APN 8 123,592,111 (GRCm39) missense probably benign 0.00
R0310:Cdh15 UTSW 8 123,592,175 (GRCm39) missense probably damaging 1.00
R0441:Cdh15 UTSW 8 123,587,705 (GRCm39) missense probably damaging 1.00
R0766:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R0898:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1023:Cdh15 UTSW 8 123,591,939 (GRCm39) missense probably damaging 0.98
R1054:Cdh15 UTSW 8 123,591,076 (GRCm39) missense possibly damaging 0.85
R1072:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R1081:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1101:Cdh15 UTSW 8 123,587,585 (GRCm39) missense possibly damaging 0.93
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1208:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1209:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1210:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1312:Cdh15 UTSW 8 123,588,188 (GRCm39) intron probably benign
R1317:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1318:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1393:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1428:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1429:Cdh15 UTSW 8 123,584,234 (GRCm39) missense probably damaging 1.00
R1695:Cdh15 UTSW 8 123,588,755 (GRCm39) missense probably benign 0.05
R2157:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2170:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2178:Cdh15 UTSW 8 123,591,715 (GRCm39) splice site probably null
R2252:Cdh15 UTSW 8 123,584,161 (GRCm39) missense probably damaging 1.00
R2290:Cdh15 UTSW 8 123,586,056 (GRCm39) missense probably damaging 1.00
R2317:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2330:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2345:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2349:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2353:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2566:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2567:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2568:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2893:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2894:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R2937:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2938:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2990:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2992:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R2993:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3029:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3030:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3195:Cdh15 UTSW 8 123,583,374 (GRCm39) missense probably benign 0.10
R3441:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3442:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3608:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R3686:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4119:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4120:Cdh15 UTSW 8 123,590,162 (GRCm39) missense probably damaging 1.00
R4477:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4478:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4480:Cdh15 UTSW 8 123,591,415 (GRCm39) missense probably benign 0.00
R4580:Cdh15 UTSW 8 123,591,897 (GRCm39) missense probably damaging 0.99
R4583:Cdh15 UTSW 8 123,591,767 (GRCm39) missense probably damaging 0.98
R4619:Cdh15 UTSW 8 123,587,612 (GRCm39) missense probably damaging 1.00
R4694:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R4731:Cdh15 UTSW 8 123,588,763 (GRCm39) missense probably damaging 1.00
R5076:Cdh15 UTSW 8 123,591,087 (GRCm39) missense possibly damaging 0.82
R5347:Cdh15 UTSW 8 123,588,802 (GRCm39) missense probably null 1.00
R5375:Cdh15 UTSW 8 123,591,839 (GRCm39) missense probably damaging 1.00
R5498:Cdh15 UTSW 8 123,591,917 (GRCm39) missense possibly damaging 0.79
R5778:Cdh15 UTSW 8 123,583,326 (GRCm39) missense possibly damaging 0.80
R6320:Cdh15 UTSW 8 123,591,086 (GRCm39) missense probably benign 0.01
R6570:Cdh15 UTSW 8 123,584,130 (GRCm39) missense probably damaging 1.00
R6708:Cdh15 UTSW 8 123,590,294 (GRCm39) missense probably benign 0.32
R7505:Cdh15 UTSW 8 123,575,231 (GRCm39) missense probably benign 0.01
R7527:Cdh15 UTSW 8 123,588,865 (GRCm39) missense probably damaging 1.00
R7724:Cdh15 UTSW 8 123,593,700 (GRCm39) missense probably damaging 1.00
R8093:Cdh15 UTSW 8 123,593,574 (GRCm39) missense probably damaging 1.00
R8485:Cdh15 UTSW 8 123,584,105 (GRCm39) missense probably damaging 1.00
R8759:Cdh15 UTSW 8 123,587,628 (GRCm39) missense probably damaging 1.00
R8910:Cdh15 UTSW 8 123,575,240 (GRCm39) missense probably benign 0.04
R9017:Cdh15 UTSW 8 123,584,256 (GRCm39) critical splice donor site probably null
R9453:Cdh15 UTSW 8 123,586,029 (GRCm39) missense probably damaging 0.99
R9699:Cdh15 UTSW 8 123,588,769 (GRCm39) missense probably benign 0.00
R9705:Cdh15 UTSW 8 123,591,024 (GRCm39) missense probably damaging 1.00
Z1176:Cdh15 UTSW 8 123,590,998 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCAATATCCAGGAGCAGCTC -3'
(R):5'- GATGGATTCTAGCTGAGGGAAC -3'

Sequencing Primer
(F):5'- TGGGATCCATGGCTCTGGAAAC -3'
(R):5'- TTCTAGCTGAGGGAACACACATGAC -3'
Posted On 2014-10-30