Incidental Mutation 'R2354:Sstr5'
ID246844
Institutional Source Beutler Lab
Gene Symbol Sstr5
Ensembl Gene ENSMUSG00000050824
Gene Namesomatostatin receptor 5
SynonymsSmstr5, sst5
MMRRC Submission 040336-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.125) question?
Stock #R2354 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location25489875-25497288 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 25491901 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 118 (I118T)
Ref Sequence ENSEMBL: ENSMUSP00000128787 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051864] [ENSMUST00000165183]
Predicted Effect probably benign
Transcript: ENSMUST00000051864
AA Change: I118T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000051085
Gene: ENSMUSG00000050824
AA Change: I118T

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.3e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 5.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 3.1e-64 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165183
AA Change: I118T

PolyPhen 2 Score 0.293 (Sensitivity: 0.91; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000128787
Gene: ENSMUSG00000050824
AA Change: I118T

DomainStartEndE-ValueType
low complexity region 11 25 N/A INTRINSIC
Pfam:7TM_GPCR_Srv 44 320 1.9e-9 PFAM
Pfam:7TM_GPCR_Srx 45 317 3.5e-10 PFAM
Pfam:7TM_GPCR_Srsx 48 318 1.3e-19 PFAM
Pfam:7tm_1 54 303 1.9e-71 PFAM
Pfam:7TM_GPCR_Srw 195 321 1e-8 PFAM
Meta Mutation Damage Score 0.1152 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.2%
Validation Efficiency 97% (34/35)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Somatostatin and its related peptide cortistatin exert multiple biological actions on normal and tumoral tissue targets by interacting with somatostatin receptors (SSTRs). The protein encoded by this gene is one of the SSTRs, which is a multi-pass membrane protein and belongs to the G-protein coupled receptor 1 family. The activity of this receptor is mediated by G proteins which inhibit adenylyl cyclase, and different regions of this receptor molecule are required for the activation of different signaling pathways. A mutation in this gene results in somatostatin analog resistance. Alternatively spliced transcript variants have been identified in this gene.[provided by RefSeq, Feb 2010]
PHENOTYPE: Homozygotes for one null allele display decreased numbers of insulin positive cells in the pancreas. Homozygotes for a second null allele have normal pancreatic islet morphology but increased insulin secretion, decreased blood insulin and glucose levels,and improved glucose tolerance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930444G20Rik G T 10: 22,067,256 T275K probably benign Het
Ap3b2 C T 7: 81,473,850 probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bpifb9b C T 2: 154,311,742 L243F probably benign Het
Cd226 A T 18: 89,246,983 probably null Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cep295 A G 9: 15,334,784 I792T possibly damaging Het
Cfap46 T C 7: 139,661,046 Y469C probably damaging Het
Col9a2 C G 4: 121,054,258 R599G probably damaging Het
D630045J12Rik G A 6: 38,158,091 P1385S possibly damaging Het
Ddb1 A T 19: 10,606,973 M64L probably benign Het
Dyrk1b G A 7: 28,185,372 R404Q possibly damaging Het
Gal3st2b A G 1: 93,939,786 T52A probably damaging Het
Galk2 C A 2: 125,931,273 S208R probably benign Het
Gm6169 G A 13: 97,098,801 T146I probably damaging Het
Hap1 A T 11: 100,354,715 I141N probably damaging Het
Hif3a T C 7: 17,041,105 S523G probably damaging Het
Kirrel C T 3: 87,088,485 V381I probably damaging Het
Lmbrd1 T C 1: 24,685,541 S69P probably damaging Het
Lrriq1 C T 10: 103,189,987 V925M probably damaging Het
Mmp16 A G 4: 18,112,001 Y459C probably damaging Het
Mtr A G 13: 12,188,157 probably benign Het
Nadk2 T A 15: 9,085,782 I167N probably damaging Het
Neo1 A G 9: 58,985,634 F242L probably benign Het
Pitpnm2 A T 5: 124,122,919 V1010E probably damaging Het
Shox2 A G 3: 66,981,489 I23T possibly damaging Het
Slc5a12 T C 2: 110,609,432 V141A probably damaging Het
Taar4 A G 10: 23,961,014 N174S probably damaging Het
Tpcn2 C A 7: 145,257,218 G581W probably damaging Het
Umod C T 7: 119,466,193 V538M probably damaging Het
Vmn2r44 T G 7: 8,370,640 S517R probably damaging Het
Zc3h12d G T 10: 7,867,938 V491L probably benign Het
Zfp358 A T 8: 3,495,454 H12L possibly damaging Het
Zkscan7 A G 9: 122,894,827 D287G probably benign Het
Other mutations in Sstr5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01532:Sstr5 APN 17 25491331 missense probably damaging 1.00
IGL01738:Sstr5 APN 17 25491610 missense probably damaging 1.00
IGL02212:Sstr5 APN 17 25491673 missense possibly damaging 0.93
IGL03098:Sstr5 UTSW 17 25491277 missense probably benign 0.00
R0402:Sstr5 UTSW 17 25492034 missense probably benign 0.15
R1576:Sstr5 UTSW 17 25491298 missense possibly damaging 0.94
R4392:Sstr5 UTSW 17 25491224 missense probably benign
R5339:Sstr5 UTSW 17 25491199 missense probably benign 0.00
R5469:Sstr5 UTSW 17 25492069 missense probably damaging 1.00
R5865:Sstr5 UTSW 17 25491244 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TCCTGGACATCCGCAAAGAC -3'
(R):5'- CGGTATTAGTGCCTGTGCTCTAC -3'

Sequencing Primer
(F):5'- TGGACATCCGCAAAGACCAAGAG -3'
(R):5'- ACACACTGGTCATCTATGTGG -3'
Posted On2014-10-30