Incidental Mutation 'R0285:Esyt1'
ID24686
Institutional Source Beutler Lab
Gene Symbol Esyt1
Ensembl Gene ENSMUSG00000025366
Gene Nameextended synaptotagmin-like protein 1
Synonymsvp115, Mbc2, Fam62a
MMRRC Submission 038506-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.190) question?
Stock #R0285 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location128509965-128525871 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 128512218 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 898 (I898F)
Ref Sequence ENSEMBL: ENSMUSP00000026427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026427]
Predicted Effect possibly damaging
Transcript: ENSMUST00000026427
AA Change: I898F

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000026427
Gene: ENSMUSG00000025366
AA Change: I898F

DomainStartEndE-ValueType
low complexity region 26 44 N/A INTRINSIC
transmembrane domain 52 74 N/A INTRINSIC
Pfam:SMP_LBD 125 303 4.3e-80 PFAM
C2 320 422 1.27e-17 SMART
C2 469 563 4.62e-11 SMART
C2 635 737 4.05e-25 SMART
C2 786 879 3.05e-11 SMART
low complexity region 909 921 N/A INTRINSIC
C2 975 1080 1.51e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000217948
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218092
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220045
Predicted Effect probably benign
Transcript: ENSMUST00000220429
Meta Mutation Damage Score 0.2 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,533,865 G5S probably damaging Het
Acy3 A G 19: 3,988,193 E162G probably benign Het
Angptl1 T C 1: 156,845,215 S204P probably benign Het
Atf6b C T 17: 34,650,396 probably benign Het
Card11 G A 5: 140,887,101 S619F probably damaging Het
Ccl11 G A 11: 82,062,258 V81I probably damaging Het
Cds1 T C 5: 101,797,038 I126T probably damaging Het
Chd1 A G 17: 17,374,680 probably benign Het
Cndp1 C A 18: 84,618,238 V384F possibly damaging Het
Cuta A G 17: 26,939,449 probably null Het
Diaph3 G A 14: 87,115,024 T47I possibly damaging Het
Dopey1 A T 9: 86,512,639 S598C probably damaging Het
Dsp A G 13: 38,172,794 M217V probably benign Het
Fam189a2 G A 19: 23,979,385 probably benign Het
Fam205a1 G A 4: 42,850,236 T640M probably benign Het
Fam84b T C 15: 60,822,967 H310R probably benign Het
Fgd3 A T 13: 49,263,948 W680R possibly damaging Het
Folh1 A G 7: 86,742,165 probably benign Het
Fuk G C 8: 110,893,717 H235Q probably benign Het
Gadl1 C A 9: 116,030,738 probably benign Het
Garem1 A G 18: 21,129,612 M715T probably benign Het
Gpd2 A T 2: 57,338,955 D257V probably benign Het
Hdac7 A G 15: 97,798,222 probably null Het
Heatr5b A G 17: 78,808,453 M858T probably benign Het
Inpp4b A T 8: 82,034,516 probably benign Het
Iqgap3 G T 3: 88,096,990 C461F probably benign Het
Lamb1 C A 12: 31,326,645 C559* probably null Het
Lrrc31 T C 3: 30,684,948 N308S probably benign Het
Ly75 T C 2: 60,318,319 Y1222C probably damaging Het
Map3k10 C A 7: 27,673,900 R42L probably benign Het
Meioc A G 11: 102,672,191 T72A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp11 T C 10: 75,925,668 Y366C probably damaging Het
N4bp2 T A 5: 65,806,559 D650E probably benign Het
Ncoa6 T C 2: 155,415,701 M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nol4l G A 2: 153,483,853 probably benign Het
Notch1 T G 2: 26,460,861 D2089A possibly damaging Het
Olfr1156 A G 2: 87,950,131 I34T probably damaging Het
Olfr1419 A G 19: 11,871,138 L26P probably damaging Het
Olfr1449 A T 19: 12,935,172 M145L probably benign Het
Olfr155 G A 4: 43,854,398 V30M possibly damaging Het
Olfr493 A G 7: 108,346,499 S161P probably benign Het
Olfr649 A T 7: 104,189,324 Y294* probably null Het
Olfr930 T A 9: 38,930,774 I201N possibly damaging Het
Otof C T 5: 30,379,533 probably null Het
Paox T C 7: 140,129,140 F324L probably damaging Het
Pycr1 A T 11: 120,640,316 I277N probably benign Het
R3hcc1l A T 19: 42,576,129 H627L probably damaging Het
Rab21 G A 10: 115,290,863 S193L probably benign Het
Ralgds T G 2: 28,550,569 probably null Het
Rbm42 A G 7: 30,645,840 S169P possibly damaging Het
Rfpl4 A G 7: 5,110,378 V262A probably benign Het
Rhobtb3 A G 13: 75,877,509 I496T possibly damaging Het
Rnf31 G A 14: 55,601,389 A901T probably damaging Het
Ryr2 T C 13: 11,716,977 D2359G probably damaging Het
Sgo2b A C 8: 63,928,789 Y336* probably null Het
Slc16a7 T A 10: 125,294,631 I62L probably benign Het
Slc22a21 A T 11: 53,959,196 probably benign Het
Slc25a21 A G 12: 56,858,025 probably null Het
Slc5a4b T C 10: 76,062,283 I532M probably damaging Het
Srrm4 C A 5: 116,467,789 probably benign Het
Stxbp1 C A 2: 32,823,542 E27D probably benign Het
Sult2a5 T A 7: 13,628,760 Y131N probably damaging Het
Svopl T C 6: 37,984,522 Q492R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Tmprss11c A G 5: 86,271,430 L90P probably damaging Het
Tmprss6 T A 15: 78,452,868 D346V probably damaging Het
Ubr4 A C 4: 139,440,801 S2820R probably damaging Het
Usp4 T C 9: 108,378,564 V607A probably benign Het
Usp45 A G 4: 21,798,603 probably null Het
Vill C T 9: 119,070,827 probably benign Het
Vmn1r13 C A 6: 57,209,994 T46N probably benign Het
Vmn2r107 A G 17: 20,345,611 T63A probably benign Het
Vmn2r82 T A 10: 79,396,557 W797R probably damaging Het
Washc2 T A 6: 116,221,839 D287E probably damaging Het
Xpc G A 6: 91,498,064 L660F probably damaging Het
Other mutations in Esyt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Esyt1 APN 10 128517635 missense possibly damaging 0.94
IGL00518:Esyt1 APN 10 128521874 missense probably benign 0.00
IGL00534:Esyt1 APN 10 128515684 critical splice donor site probably null
IGL00578:Esyt1 APN 10 128511743 missense probably damaging 1.00
IGL00899:Esyt1 APN 10 128517063 missense probably damaging 1.00
IGL01308:Esyt1 APN 10 128519791 missense possibly damaging 0.62
IGL01373:Esyt1 APN 10 128518941 missense possibly damaging 0.91
IGL01476:Esyt1 APN 10 128511494 missense probably damaging 0.99
IGL01655:Esyt1 APN 10 128522312 missense possibly damaging 0.72
IGL02302:Esyt1 APN 10 128512367 missense probably damaging 1.00
IGL02441:Esyt1 APN 10 128512424 missense possibly damaging 0.89
IGL02550:Esyt1 APN 10 128522093 missense probably damaging 1.00
IGL02653:Esyt1 APN 10 128511008 missense probably benign
IGL02948:Esyt1 APN 10 128519171 missense probably damaging 0.96
IGL02986:Esyt1 APN 10 128516757 missense probably damaging 0.96
IGL03033:Esyt1 APN 10 128516383 missense probably benign 0.00
R0039:Esyt1 UTSW 10 128520962 missense probably damaging 0.99
R0453:Esyt1 UTSW 10 128512209 missense probably benign 0.00
R1123:Esyt1 UTSW 10 128516558 missense probably benign 0.35
R1496:Esyt1 UTSW 10 128512428 missense possibly damaging 0.63
R1569:Esyt1 UTSW 10 128518994 missense possibly damaging 0.88
R1691:Esyt1 UTSW 10 128525534 missense probably benign 0.01
R1813:Esyt1 UTSW 10 128519618 missense probably benign
R1827:Esyt1 UTSW 10 128516369 missense probably benign 0.01
R2038:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2039:Esyt1 UTSW 10 128511951 missense probably benign 0.00
R2115:Esyt1 UTSW 10 128522104 missense probably damaging 0.99
R2696:Esyt1 UTSW 10 128517045 missense probably damaging 1.00
R3919:Esyt1 UTSW 10 128521036 unclassified probably benign
R3980:Esyt1 UTSW 10 128511524 missense probably damaging 0.99
R4223:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R4225:Esyt1 UTSW 10 128520648 missense probably damaging 1.00
R5249:Esyt1 UTSW 10 128516574 missense probably benign 0.00
R5534:Esyt1 UTSW 10 128519460 missense probably benign 0.07
R5704:Esyt1 UTSW 10 128511510 missense probably damaging 1.00
R6252:Esyt1 UTSW 10 128511902 missense probably benign 0.01
R6431:Esyt1 UTSW 10 128516674 critical splice donor site probably null
R7013:Esyt1 UTSW 10 128525651 missense probably damaging 1.00
R7102:Esyt1 UTSW 10 128516236 missense probably damaging 0.98
R7152:Esyt1 UTSW 10 128515760 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- TCTAAGAACCCCGTGACTCATCTCC -3'
(R):5'- ATCACTGCATTTGCCCCACAGG -3'

Sequencing Primer
(F):5'- ATCCTCCTGCCTGCACATTAC -3'
(R):5'- ATTTGCCCCACAGGTTCGG -3'
Posted On2013-04-16