Incidental Mutation 'R2355:Abcb9'
List |< first << previous [record 43 of 1259] next >> last >|
ID246861
Institutional Source Beutler Lab
Gene Symbol Abcb9
Ensembl Gene ENSMUSG00000029408
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 9
SynonymsTAPL
MMRRC Submission 040337-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2355 (G1)
Quality Score217
Status Not validated
Chromosome5
Chromosomal Location124061530-124095798 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 124077305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031354] [ENSMUST00000126856] [ENSMUST00000141510]
Predicted Effect probably null
Transcript: ENSMUST00000031354
SMART Domains Protein: ENSMUSP00000031354
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 184 453 1.9e-61 PFAM
AAA 527 713 4.07e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126856
SMART Domains Protein: ENSMUSP00000118908
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141510
SMART Domains Protein: ENSMUSP00000122969
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196486
Meta Mutation Damage Score 0.6092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may be associated with lysosome activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ahcyl1 A G 3: 107,670,217 S296P probably damaging Het
Alas1 A G 9: 106,236,474 V524A probably damaging Het
Amn C A 12: 111,271,812 D53E probably damaging Het
Bbof1 A G 12: 84,423,449 E33G probably damaging Het
Ccdc149 T C 5: 52,420,772 E106G probably damaging Het
Ceacam5 T A 7: 17,745,635 S226T probably damaging Het
Chd7 G T 4: 8,801,350 S698I possibly damaging Het
Chst2 A G 9: 95,406,095 L66P probably damaging Het
Cps1 C T 1: 67,156,224 P268L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp3a59 A T 5: 146,099,812 M275L probably benign Het
Ddx41 T G 13: 55,534,300 M232L probably benign Het
Dnah6 C A 6: 73,156,421 A1068S possibly damaging Het
Dnah7a T C 1: 53,582,502 I1155V probably benign Het
Dopey2 G A 16: 93,770,677 V611I probably damaging Het
Epyc A G 10: 97,677,013 Y243C probably damaging Het
Fam171a1 C T 2: 3,225,533 Q568* probably null Het
Gm5930 A G 14: 44,336,461 S105P probably damaging Het
Golga4 A G 9: 118,560,742 D2032G probably benign Het
Gps2 AGTGCT A 11: 69,915,381 probably null Het
H2-DMb1 A G 17: 34,157,315 Y136C probably damaging Het
Il12b A G 11: 44,410,212 E185G probably benign Het
Kat7 A C 11: 95,291,581 I231R probably benign Het
Kcmf1 A T 6: 72,850,483 I58N probably damaging Het
Lmf2 A T 15: 89,351,763 V646E possibly damaging Het
Lmo7 A G 14: 101,888,685 Q409R probably damaging Het
Lmod1 T A 1: 135,364,515 H369Q probably benign Het
M1ap G A 6: 82,956,503 A13T probably benign Het
Mapk8ip2 G T 15: 89,458,965 V637L probably benign Het
Mettl25 C A 10: 105,763,455 V570L probably benign Het
Mfsd1 T A 3: 67,601,335 N449K probably damaging Het
Olfr1449 T C 19: 12,935,019 S94P possibly damaging Het
Olfr683 A T 7: 105,143,813 M166K probably benign Het
Olfr73 T A 2: 88,035,035 I35F probably damaging Het
Olfr799 G A 10: 129,647,842 C238Y probably benign Het
Pcdhb5 T A 18: 37,322,116 S516R probably benign Het
Plppr3 C T 10: 79,865,360 M549I possibly damaging Het
Ppl A G 16: 5,094,497 V740A probably benign Het
Rabgef1 C T 5: 130,212,087 T349M probably benign Het
Rad51ap2 T C 12: 11,457,108 C344R probably benign Het
Shank2 A G 7: 144,057,718 Q172R possibly damaging Het
Smg9 G A 7: 24,420,121 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Trim42 A T 9: 97,359,240 N646K probably damaging Het
Usp32 T C 11: 85,005,909 I1181V probably benign Het
Vwa5b1 C A 4: 138,591,910 probably null Het
Other mutations in Abcb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Abcb9 APN 5 124077238 missense possibly damaging 0.90
R0045:Abcb9 UTSW 5 124082085 missense probably damaging 0.96
R0106:Abcb9 UTSW 5 124083060 missense possibly damaging 0.70
R0153:Abcb9 UTSW 5 124080056 missense probably benign 0.00
R0194:Abcb9 UTSW 5 124077295 missense probably damaging 0.99
R0458:Abcb9 UTSW 5 124082146 critical splice acceptor site probably null
R0669:Abcb9 UTSW 5 124062887 missense probably damaging 0.97
R1240:Abcb9 UTSW 5 124089921 missense probably benign 0.02
R1480:Abcb9 UTSW 5 124078826 missense probably benign 0.00
R1544:Abcb9 UTSW 5 124083631 missense probably benign
R1878:Abcb9 UTSW 5 124090136 missense probably benign 0.02
R2358:Abcb9 UTSW 5 124077305 frame shift probably null
R2520:Abcb9 UTSW 5 124080028 splice site probably null
R2926:Abcb9 UTSW 5 124078839 missense possibly damaging 0.84
R3795:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R3911:Abcb9 UTSW 5 124089846 missense probably benign 0.06
R4679:Abcb9 UTSW 5 124078804 missense probably benign 0.20
R4789:Abcb9 UTSW 5 124078790 missense probably benign 0.00
R4821:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R5116:Abcb9 UTSW 5 124078867 missense probably damaging 1.00
R5804:Abcb9 UTSW 5 124080055 missense probably benign
R5997:Abcb9 UTSW 5 124089815 missense possibly damaging 0.85
R6197:Abcb9 UTSW 5 124071749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GCTGTTCTTACCTGTAGGACC -3'
(R):5'- ACACAGTGGCGTTACATTCCC -3'

Sequencing Primer
(F):5'- CTTACCTGTAGGACCTGTGTG -3'
(R):5'- ATCAGTGGTAGGTGTCAG -3'
Posted On2014-10-30