Mutagenetix > Incidental Mutation

Incidental Mutation 'R2355:Shank2'

246872

Institutional Source

Beutler Lab

Gene Symbol

Shank2

Ensembl Gene

ENSMUSG00000037541

Gene Name

SH3 and multiple ankyrin repeat domains 2

Synonyms

ProSAP1

MMRRC Submission

040337-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2355 (G1)

Quality Score

207

Status

Not validated

Chromosome

Chromosomal Location

143555665-143978231 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 143611455 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Arginine at position 172 (Q172R)

Ref Sequence

ENSEMBL: ENSMUSP00000101522 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000105902] [ENSMUST00000213146]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000105902
AA Change: Q172R

PolyPhen 2 Score 0.942 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000101522
Gene: ENSMUSG00000037541
AA Change: Q172R

Domain	Start	End	E-Value	Type
low complexity region	15	28	N/A	INTRINSIC
Pfam:FERM_f0	57	140	1.4e-21	PFAM
ANK	196	226	1.4e1	SMART
ANK	230	259	2.77e-3	SMART
ANK	263	293	1.42e0	SMART
ANK	297	326	1.25e-1	SMART
ANK	330	359	7.83e-3	SMART
ANK	363	391	1.29e2	SMART
SH3	529	584	1.04e-14	SMART
PDZ	635	720	1.75e-14	SMART
low complexity region	724	743	N/A	INTRINSIC
low complexity region	878	893	N/A	INTRINSIC
low complexity region	1031	1043	N/A	INTRINSIC
low complexity region	1118	1129	N/A	INTRINSIC
low complexity region	1149	1161	N/A	INTRINSIC
low complexity region	1198	1216	N/A	INTRINSIC
low complexity region	1393	1407	N/A	INTRINSIC
low complexity region	1462	1473	N/A	INTRINSIC
low complexity region	1494	1516	N/A	INTRINSIC
low complexity region	1530	1546	N/A	INTRINSIC
low complexity region	1568	1576	N/A	INTRINSIC
low complexity region	1656	1670	N/A	INTRINSIC
low complexity region	1713	1728	N/A	INTRINSIC
low complexity region	1752	1766	N/A	INTRINSIC
SAM	1775	1841	2.52e-23	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000213146
AA Change: Q172R

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)

Coding Region Coverage

1x: 99.3%
3x: 98.7%
10x: 97.5%
20x: 95.5%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is a member of the Shank family of synaptic proteins that may function as molecular scaffolds in the postsynaptic density of excitatory synapses. Shank proteins contain multiple domains for protein-protein interaction, including ankyrin repeats, and an SH3 domain. This particular family member contains a PDZ domain, a consensus sequence for cortactin SH3 domain-binding peptides and a sterile alpha motif. The alternative splicing demonstrated in Shank genes has been suggested as a mechanism for regulating the molecular structure of Shank and the spectrum of Shank-interacting proteins in the postsynaptic densities of the adult and developing brain. Alterations in the encoded protein may be associated with susceptibility to autism spectrum disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for null mutations display hyperactivity and abnormal social behavior. Mice homozygous for one null allele also display partial postnal lethality and limb grasping. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 46 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb9	CGG	CG	5: 124,215,368 (GRCm39)		probably null	Het
Ahcyl1	A	G	3: 107,577,533 (GRCm39)	S296P	probably damaging	Het
Alas1	A	G	9: 106,113,673 (GRCm39)	V524A	probably damaging	Het
Amn	C	A	12: 111,238,246 (GRCm39)	D53E	probably damaging	Het
Bbof1	A	G	12: 84,470,223 (GRCm39)	E33G	probably damaging	Het
Ccdc149	T	C	5: 52,578,114 (GRCm39)	E106G	probably damaging	Het
Ceacam5	T	A	7: 17,479,560 (GRCm39)	S226T	probably damaging	Het
Chd7	G	T	4: 8,801,350 (GRCm39)	S698I	possibly damaging	Het
Chst2	A	G	9: 95,288,148 (GRCm39)	L66P	probably damaging	Het
Cps1	C	T	1: 67,195,383 (GRCm39)	P268L	probably damaging	Het
Csmd3	CCTTTGCGCTT	CCTT	15: 47,604,632 (GRCm39)		probably null	Het
Cyp3a59	A	T	5: 146,036,622 (GRCm39)	M275L	probably benign	Het
Ddx41	T	G	13: 55,682,113 (GRCm39)	M232L	probably benign	Het
Dnah6	C	A	6: 73,133,404 (GRCm39)	A1068S	possibly damaging	Het
Dnah7a	T	C	1: 53,621,661 (GRCm39)	I1155V	probably benign	Het
Dop1b	G	A	16: 93,567,565 (GRCm39)	V611I	probably damaging	Het
Epyc	A	G	10: 97,512,875 (GRCm39)	Y243C	probably damaging	Het
Fam171a1	C	T	2: 3,226,570 (GRCm39)	Q568*	probably null	Het
Gm5930	A	G	14: 44,573,918 (GRCm39)	S105P	probably damaging	Het
Golga4	A	G	9: 118,389,810 (GRCm39)	D2032G	probably benign	Het
Gps2	AGTGCT	A	11: 69,806,207 (GRCm39)		probably null	Het
H2-DMb1	A	G	17: 34,376,289 (GRCm39)	Y136C	probably damaging	Het
Il12b	A	G	11: 44,301,039 (GRCm39)	E185G	probably benign	Het
Kat7	A	C	11: 95,182,407 (GRCm39)	I231R	probably benign	Het
Kcmf1	A	T	6: 72,827,466 (GRCm39)	I58N	probably damaging	Het
Lmf2	A	T	15: 89,235,966 (GRCm39)	V646E	possibly damaging	Het
Lmo7	A	G	14: 102,126,121 (GRCm39)	Q409R	probably damaging	Het
Lmod1	T	A	1: 135,292,253 (GRCm39)	H369Q	probably benign	Het
M1ap	G	A	6: 82,933,484 (GRCm39)	A13T	probably benign	Het
Mapk8ip2	G	T	15: 89,343,168 (GRCm39)	V637L	probably benign	Het
Mettl25	C	A	10: 105,599,316 (GRCm39)	V570L	probably benign	Het
Mfsd1	T	A	3: 67,508,668 (GRCm39)	N449K	probably damaging	Het
Or56a5	A	T	7: 104,793,020 (GRCm39)	M166K	probably benign	Het
Or5b24	T	C	19: 12,912,383 (GRCm39)	S94P	possibly damaging	Het
Or5d18	T	A	2: 87,865,379 (GRCm39)	I35F	probably damaging	Het
Or6c209	G	A	10: 129,483,711 (GRCm39)	C238Y	probably benign	Het
Pcdhb5	T	A	18: 37,455,169 (GRCm39)	S516R	probably benign	Het
Plppr3	C	T	10: 79,701,194 (GRCm39)	M549I	possibly damaging	Het
Ppl	A	G	16: 4,912,361 (GRCm39)	V740A	probably benign	Het
Rabgef1	C	T	5: 130,240,928 (GRCm39)	T349M	probably benign	Het
Rad51ap2	T	C	12: 11,507,109 (GRCm39)	C344R	probably benign	Het
Smg9	G	A	7: 24,119,546 (GRCm39)		probably null	Het
Tectb	C	G	19: 55,169,431 (GRCm39)		probably benign	Het
Trim42	A	T	9: 97,241,293 (GRCm39)	N646K	probably damaging	Het
Usp32	T	C	11: 84,896,735 (GRCm39)	I1181V	probably benign	Het
Vwa5b1	C	A	4: 138,319,221 (GRCm39)		probably null	Het

Other mutations in Shank2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00332:Shank2	APN	7	143,965,584 (GRCm39)	missense	probably damaging	1.00
IGL00516:Shank2	APN	7	143,964,512 (GRCm39)	missense	possibly damaging	0.96
IGL00919:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably damaging	0.97
IGL01450:Shank2	APN	7	143,838,805 (GRCm39)	nonsense	probably null
IGL01996:Shank2	APN	7	143,965,230 (GRCm39)	missense	probably damaging	1.00
IGL02217:Shank2	APN	7	143,838,784 (GRCm39)	missense	possibly damaging	0.59
IGL02314:Shank2	APN	7	143,965,008 (GRCm39)	missense	probably benign	0.01
IGL02320:Shank2	APN	7	143,974,681 (GRCm39)	missense	probably damaging	1.00
IGL02948:Shank2	APN	7	143,963,373 (GRCm39)	missense	probably benign	0.03
IGL02997:Shank2	APN	7	143,635,610 (GRCm39)	missense	probably benign	0.16
R0077:Shank2	UTSW	7	143,746,204 (GRCm39)	missense	possibly damaging	0.85
R0109:Shank2	UTSW	7	143,964,314 (GRCm39)	missense	possibly damaging	0.81
R0126:Shank2	UTSW	7	143,585,092 (GRCm39)	missense	probably damaging	0.99
R0153:Shank2	UTSW	7	143,623,872 (GRCm39)	missense	probably benign	0.04
R0644:Shank2	UTSW	7	143,965,586 (GRCm39)	missense	probably benign
R1072:Shank2	UTSW	7	143,965,305 (GRCm39)	missense	probably damaging	1.00
R1245:Shank2	UTSW	7	143,965,457 (GRCm39)	missense	probably benign	0.00
R1424:Shank2	UTSW	7	143,606,109 (GRCm39)	missense	probably damaging	0.99
R1712:Shank2	UTSW	7	143,964,890 (GRCm39)	missense	probably damaging	1.00
R1739:Shank2	UTSW	7	143,733,590 (GRCm39)	missense	probably damaging	1.00
R1791:Shank2	UTSW	7	143,964,336 (GRCm39)	missense	probably damaging	1.00
R1889:Shank2	UTSW	7	143,740,595 (GRCm39)	nonsense	probably null
R2074:Shank2	UTSW	7	143,963,277 (GRCm39)	missense	probably damaging	1.00
R2135:Shank2	UTSW	7	143,964,971 (GRCm39)	missense	probably damaging	0.99
R2511:Shank2	UTSW	7	143,965,314 (GRCm39)	missense	probably damaging	1.00
R2517:Shank2	UTSW	7	143,606,042 (GRCm39)	missense	possibly damaging	0.89
R2570:Shank2	UTSW	7	143,622,507 (GRCm39)	missense	probably damaging	1.00
R2846:Shank2	UTSW	7	143,623,792 (GRCm39)	missense	probably damaging	1.00
R3159:Shank2	UTSW	7	143,635,611 (GRCm39)	missense	probably damaging	0.98
R3881:Shank2	UTSW	7	143,959,121 (GRCm39)	missense	probably benign
R3907:Shank2	UTSW	7	143,963,313 (GRCm39)	missense	probably damaging	1.00
R3938:Shank2	UTSW	7	143,682,112 (GRCm39)	missense	probably benign	0.20
R4151:Shank2	UTSW	7	143,608,565 (GRCm39)	missense	probably damaging	1.00
R4369:Shank2	UTSW	7	143,733,518 (GRCm39)	missense	probably damaging	0.99
R4372:Shank2	UTSW	7	143,964,599 (GRCm39)	missense	probably benign	0.09
R4519:Shank2	UTSW	7	143,963,942 (GRCm39)	missense	probably damaging	1.00
R4627:Shank2	UTSW	7	143,965,161 (GRCm39)	missense	probably damaging	1.00
R4645:Shank2	UTSW	7	143,964,159 (GRCm39)	missense	possibly damaging	0.65
R4647:Shank2	UTSW	7	143,965,566 (GRCm39)	missense	probably damaging	1.00
R4689:Shank2	UTSW	7	143,974,342 (GRCm39)	missense	probably benign	0.07
R4751:Shank2	UTSW	7	143,963,205 (GRCm39)	missense	probably damaging	1.00
R4816:Shank2	UTSW	7	143,606,043 (GRCm39)	missense	probably damaging	1.00
R4843:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R4929:Shank2	UTSW	7	143,965,008 (GRCm39)	missense	probably benign	0.01
R5009:Shank2	UTSW	7	143,623,916 (GRCm39)	missense	probably benign	0.00
R5027:Shank2	UTSW	7	143,812,842 (GRCm39)	nonsense	probably null
R5165:Shank2	UTSW	7	143,963,373 (GRCm39)	missense	possibly damaging	0.62
R5278:Shank2	UTSW	7	143,622,612 (GRCm39)	critical splice donor site	probably null
R5332:Shank2	UTSW	7	143,965,029 (GRCm39)	missense	possibly damaging	0.82
R5497:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R5525:Shank2	UTSW	7	143,623,846 (GRCm39)	missense	probably damaging	1.00
R5575:Shank2	UTSW	7	143,963,871 (GRCm39)	missense	probably damaging	1.00
R5948:Shank2	UTSW	7	143,960,960 (GRCm39)	missense	probably damaging	0.98
R6024:Shank2	UTSW	7	143,733,768 (GRCm39)	missense	probably benign	0.12
R6306:Shank2	UTSW	7	143,963,417 (GRCm39)	missense	probably benign	0.00
R6317:Shank2	UTSW	7	143,838,821 (GRCm39)	missense	possibly damaging	0.89
R6358:Shank2	UTSW	7	143,585,034 (GRCm39)	missense	probably benign	0.25
R6364:Shank2	UTSW	7	143,964,146 (GRCm39)	missense	probably benign	0.14
R6413:Shank2	UTSW	7	143,963,955 (GRCm39)	missense	probably damaging	1.00
R6680:Shank2	UTSW	7	143,974,603 (GRCm39)	missense	probably damaging	1.00
R6834:Shank2	UTSW	7	143,963,631 (GRCm39)	missense	probably damaging	1.00
R6870:Shank2	UTSW	7	143,606,197 (GRCm39)	missense	probably damaging	0.99
R6933:Shank2	UTSW	7	143,645,515 (GRCm39)	missense	probably benign	0.19
R6983:Shank2	UTSW	7	143,635,585 (GRCm39)	missense	possibly damaging	0.94
R7082:Shank2	UTSW	7	143,964,096 (GRCm39)	missense	probably damaging	0.99
R7100:Shank2	UTSW	7	143,964,901 (GRCm39)	missense	possibly damaging	0.73
R7111:Shank2	UTSW	7	143,965,289 (GRCm39)	missense	probably benign	0.00
R7213:Shank2	UTSW	7	143,585,146 (GRCm39)	missense	probably benign	0.17
R7225:Shank2	UTSW	7	143,838,762 (GRCm39)	missense	probably benign	0.42
R7325:Shank2	UTSW	7	143,965,422 (GRCm39)	missense	probably benign	0.04
R7605:Shank2	UTSW	7	143,645,516 (GRCm39)	missense	possibly damaging	0.64
R7909:Shank2	UTSW	7	143,965,131 (GRCm39)	missense	probably damaging	1.00
R7976:Shank2	UTSW	7	143,964,798 (GRCm39)	missense	probably damaging	0.99
R8118:Shank2	UTSW	7	143,963,612 (GRCm39)	missense	probably benign	0.01
R8722:Shank2	UTSW	7	143,729,485 (GRCm39)	intron	probably benign
R8866:Shank2	UTSW	7	143,964,986 (GRCm39)	missense	probably benign
R8919:Shank2	UTSW	7	143,965,265 (GRCm39)	missense	probably damaging	1.00
R8944:Shank2	UTSW	7	143,623,927 (GRCm39)	missense	probably damaging	1.00
R9033:Shank2	UTSW	7	143,965,236 (GRCm39)	missense	probably damaging	0.99
R9091:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9252:Shank2	UTSW	7	143,622,535 (GRCm39)	missense	possibly damaging	0.96
R9270:Shank2	UTSW	7	143,963,705 (GRCm39)	missense	possibly damaging	0.76
R9350:Shank2	UTSW	7	143,960,945 (GRCm39)	missense	probably benign	0.00
R9362:Shank2	UTSW	7	143,963,271 (GRCm39)	missense	probably damaging	1.00
R9471:Shank2	UTSW	7	143,964,752 (GRCm39)	missense	possibly damaging	0.77
R9524:Shank2	UTSW	7	143,964,183 (GRCm39)	missense	possibly damaging	0.71
R9557:Shank2	UTSW	7	143,963,847 (GRCm39)	missense	probably benign	0.00
R9559:Shank2	UTSW	7	143,585,041 (GRCm39)	missense	probably benign	0.30
R9574:Shank2	UTSW	7	143,622,462 (GRCm39)	missense	possibly damaging	0.90
R9680:Shank2	UTSW	7	143,964,837 (GRCm39)	missense	probably damaging	0.96
R9720:Shank2	UTSW	7	143,682,137 (GRCm39)	missense	probably damaging	0.99
RF009:Shank2	UTSW	7	143,965,308 (GRCm39)	missense	possibly damaging	0.81
Z1176:Shank2	UTSW	7	143,682,114 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- AGGATGACCTTGAACCACCAAT -3'
(R):5'- GGAGCAAGCCAGTAACTGTGG -3'

Sequencing Primer
(F):5'- TTGAACCACCAATCCTCCTG -3'
(R):5'- AGTAACTGTGGCCTCTGCATCAG -3'

Posted On

2014-10-30