Incidental Mutation 'R2355:Mapk8ip2'
ID246898
Institutional Source Beutler Lab
Gene Symbol Mapk8ip2
Ensembl Gene ENSMUSG00000022619
Gene Namemitogen-activated protein kinase 8 interacting protein 2
SynonymsIB2, Jip2, 3230402N03Rik, JNK-interacting protein
MMRRC Submission 040337-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.300) question?
Stock #R2355 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location89453913-89464468 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 89458965 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 637 (V637L)
Ref Sequence ENSEMBL: ENSMUSP00000023291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023291] [ENSMUST00000137755]
Predicted Effect probably benign
Transcript: ENSMUST00000023291
AA Change: V637L

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000023291
Gene: ENSMUSG00000022619
AA Change: V637L

DomainStartEndE-ValueType
low complexity region 26 40 N/A INTRINSIC
low complexity region 85 104 N/A INTRINSIC
low complexity region 176 194 N/A INTRINSIC
low complexity region 213 227 N/A INTRINSIC
low complexity region 236 249 N/A INTRINSIC
low complexity region 271 295 N/A INTRINSIC
low complexity region 300 324 N/A INTRINSIC
low complexity region 419 437 N/A INTRINSIC
low complexity region 472 490 N/A INTRINSIC
low complexity region 541 555 N/A INTRINSIC
low complexity region 589 598 N/A INTRINSIC
SH3 613 670 2.24e-10 SMART
PTB 684 823 1.19e-38 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137755
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.5%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is closely related to MAPK8IP1/IB1/JIP-1, a scaffold protein that is involved in the c-Jun amino-terminal kinase signaling pathway. This protein is expressed in brain and pancreatic cells. It has been shown to interact with, and regulate the activity of MAPK8/JNK1, and MAP2K7/MKK7 kinases. This protein thus is thought to function as a regulator of signal transduction by protein kinase cascade in brain and pancreatic beta-cells. [provided by RefSeq, Feb 2014]
PHENOTYPE: Mice homozygous for a null allele are smaller in size and exhibit male infertility. Mice homozygous for a different knock-out allele exhibit behavioral and cerebellar transmission deficits. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Ahcyl1 A G 3: 107,670,217 S296P probably damaging Het
Alas1 A G 9: 106,236,474 V524A probably damaging Het
Amn C A 12: 111,271,812 D53E probably damaging Het
Bbof1 A G 12: 84,423,449 E33G probably damaging Het
Ccdc149 T C 5: 52,420,772 E106G probably damaging Het
Ceacam5 T A 7: 17,745,635 S226T probably damaging Het
Chd7 G T 4: 8,801,350 S698I possibly damaging Het
Chst2 A G 9: 95,406,095 L66P probably damaging Het
Cps1 C T 1: 67,156,224 P268L probably damaging Het
Csmd3 CCTTTGCGCTT CCTT 15: 47,741,236 probably null Het
Cyp3a59 A T 5: 146,099,812 M275L probably benign Het
Ddx41 T G 13: 55,534,300 M232L probably benign Het
Dnah6 C A 6: 73,156,421 A1068S possibly damaging Het
Dnah7a T C 1: 53,582,502 I1155V probably benign Het
Dopey2 G A 16: 93,770,677 V611I probably damaging Het
Epyc A G 10: 97,677,013 Y243C probably damaging Het
Fam171a1 C T 2: 3,225,533 Q568* probably null Het
Gm5930 A G 14: 44,336,461 S105P probably damaging Het
Golga4 A G 9: 118,560,742 D2032G probably benign Het
Gps2 AGTGCT A 11: 69,915,381 probably null Het
H2-DMb1 A G 17: 34,157,315 Y136C probably damaging Het
Il12b A G 11: 44,410,212 E185G probably benign Het
Kat7 A C 11: 95,291,581 I231R probably benign Het
Kcmf1 A T 6: 72,850,483 I58N probably damaging Het
Lmf2 A T 15: 89,351,763 V646E possibly damaging Het
Lmo7 A G 14: 101,888,685 Q409R probably damaging Het
Lmod1 T A 1: 135,364,515 H369Q probably benign Het
M1ap G A 6: 82,956,503 A13T probably benign Het
Mettl25 C A 10: 105,763,455 V570L probably benign Het
Mfsd1 T A 3: 67,601,335 N449K probably damaging Het
Olfr1449 T C 19: 12,935,019 S94P possibly damaging Het
Olfr683 A T 7: 105,143,813 M166K probably benign Het
Olfr73 T A 2: 88,035,035 I35F probably damaging Het
Olfr799 G A 10: 129,647,842 C238Y probably benign Het
Pcdhb5 T A 18: 37,322,116 S516R probably benign Het
Plppr3 C T 10: 79,865,360 M549I possibly damaging Het
Ppl A G 16: 5,094,497 V740A probably benign Het
Rabgef1 C T 5: 130,212,087 T349M probably benign Het
Rad51ap2 T C 12: 11,457,108 C344R probably benign Het
Shank2 A G 7: 144,057,718 Q172R possibly damaging Het
Smg9 G A 7: 24,420,121 probably null Het
Tectb C G 19: 55,180,999 probably benign Het
Trim42 A T 9: 97,359,240 N646K probably damaging Het
Usp32 T C 11: 85,005,909 I1181V probably benign Het
Vwa5b1 C A 4: 138,591,910 probably null Het
Other mutations in Mapk8ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01942:Mapk8ip2 APN 15 89457017 critical splice donor site probably null
IGL02720:Mapk8ip2 APN 15 89457582 missense probably damaging 1.00
IGL02741:Mapk8ip2 APN 15 89457497 missense probably damaging 1.00
IGL03027:Mapk8ip2 APN 15 89458107 missense probably damaging 1.00
PIT4520001:Mapk8ip2 UTSW 15 89460697 missense probably damaging 1.00
R0504:Mapk8ip2 UTSW 15 89456658 missense possibly damaging 0.62
R3026:Mapk8ip2 UTSW 15 89461446 missense probably damaging 1.00
R3430:Mapk8ip2 UTSW 15 89457282 missense possibly damaging 0.86
R4275:Mapk8ip2 UTSW 15 89458995 missense probably damaging 1.00
R4789:Mapk8ip2 UTSW 15 89459038 missense probably damaging 1.00
R4953:Mapk8ip2 UTSW 15 89457228 missense probably benign
R5209:Mapk8ip2 UTSW 15 89459287 missense probably damaging 1.00
R5417:Mapk8ip2 UTSW 15 89457439 missense probably benign 0.16
R5521:Mapk8ip2 UTSW 15 89458804 missense probably damaging 1.00
R6860:Mapk8ip2 UTSW 15 89460452 missense probably damaging 1.00
R7145:Mapk8ip2 UTSW 15 89458998 missense possibly damaging 0.67
Predicted Primers PCR Primer
(F):5'- AGGCACTGAGTCCTTTGGTC -3'
(R):5'- ACACAGTCTGAGGTTGATATAGGGG -3'

Sequencing Primer
(F):5'- CCTGTGTGGTGAATGGGGAG -3'
(R):5'- GGAAGTCTGTGGTGGCAAGC -3'
Posted On2014-10-30