Incidental Mutation 'R0285:Hdac7'
ID24700
Institutional Source Beutler Lab
Gene Symbol Hdac7
Ensembl Gene ENSMUSG00000022475
Gene Namehistone deacetylase 7
SynonymsHdac7a, 5830434K02Rik
MMRRC Submission 038506-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R0285 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location97792664-97844502 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 97798222 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079838] [ENSMUST00000088402] [ENSMUST00000116408] [ENSMUST00000116409] [ENSMUST00000118294] [ENSMUST00000119670] [ENSMUST00000120683] [ENSMUST00000121514] [ENSMUST00000156045]
Predicted Effect probably null
Transcript: ENSMUST00000079838
SMART Domains Protein: ENSMUSP00000078766
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 196 211 N/A INTRINSIC
low complexity region 357 375 N/A INTRINSIC
low complexity region 426 438 N/A INTRINSIC
low complexity region 442 454 N/A INTRINSIC
low complexity region 485 498 N/A INTRINSIC
Pfam:Hist_deacetyl 523 853 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000088402
SMART Domains Protein: ENSMUSP00000085744
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
Pfam:Hist_deacetyl 517 847 2.5e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116408
SMART Domains Protein: ENSMUSP00000112109
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 825 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000116409
SMART Domains Protein: ENSMUSP00000112110
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 435 447 N/A INTRINSIC
low complexity region 451 463 N/A INTRINSIC
low complexity region 494 507 N/A INTRINSIC
Pfam:Hist_deacetyl 532 862 9.1e-83 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118294
SMART Domains Protein: ENSMUSP00000113380
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 359 377 N/A INTRINSIC
low complexity region 428 440 N/A INTRINSIC
low complexity region 444 456 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
Pfam:Hist_deacetyl 525 855 2.6e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000119670
SMART Domains Protein: ENSMUSP00000112459
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 174 189 N/A INTRINSIC
low complexity region 298 316 N/A INTRINSIC
low complexity region 374 386 N/A INTRINSIC
low complexity region 390 402 N/A INTRINSIC
low complexity region 433 446 N/A INTRINSIC
Pfam:Hist_deacetyl 471 801 2.3e-91 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000120683
SMART Domains Protein: ENSMUSP00000112446
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 398 410 N/A INTRINSIC
low complexity region 414 426 N/A INTRINSIC
low complexity region 457 470 N/A INTRINSIC
Pfam:Hist_deacetyl 495 623 7.9e-9 PFAM
Pfam:Hist_deacetyl 623 777 3.5e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121514
SMART Domains Protein: ENSMUSP00000112641
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 57 71 N/A INTRINSIC
low complexity region 75 91 N/A INTRINSIC
low complexity region 129 147 N/A INTRINSIC
low complexity region 198 213 N/A INTRINSIC
low complexity region 322 340 N/A INTRINSIC
low complexity region 392 405 N/A INTRINSIC
Pfam:Hist_deacetyl 430 760 9e-92 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134258
SMART Domains Protein: ENSMUSP00000118599
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 52 64 N/A INTRINSIC
low complexity region 68 80 N/A INTRINSIC
low complexity region 111 124 N/A INTRINSIC
PDB:3ZNS|C 127 241 5e-70 PDB
SCOP:d1c3pa_ 139 219 2e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135651
SMART Domains Protein: ENSMUSP00000119970
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 10 22 N/A INTRINSIC
low complexity region 53 66 N/A INTRINSIC
Pfam:Hist_deacetyl 166 213 8.8e-13 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151334
Predicted Effect probably benign
Transcript: ENSMUST00000156045
SMART Domains Protein: ENSMUSP00000120576
Gene: ENSMUSG00000022475

DomainStartEndE-ValueType
low complexity region 79 93 N/A INTRINSIC
low complexity region 97 113 N/A INTRINSIC
low complexity region 151 169 N/A INTRINSIC
low complexity region 220 235 N/A INTRINSIC
low complexity region 344 362 N/A INTRINSIC
low complexity region 420 432 N/A INTRINSIC
low complexity region 436 448 N/A INTRINSIC
low complexity region 479 492 N/A INTRINSIC
PDB:3ZNS|C 495 602 2e-60 PDB
SCOP:d1c3pa_ 507 587 6e-16 SMART
low complexity region 603 621 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228466
Meta Mutation Damage Score 0.542 question?
Coding Region Coverage
  • 1x: 99.0%
  • 3x: 98.1%
  • 10x: 96.1%
  • 20x: 92.9%
Validation Efficiency 99% (80/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Histones play a critical role in transcriptional regulation, cell cycle progression, and developmental events. Histone acetylation/deacetylation alters chromosome structure and affects transcription factor access to DNA. The protein encoded by this gene has sequence homology to members of the histone deacetylase family. This gene is orthologous to mouse HDAC7 gene whose protein promotes repression mediated via the transcriptional corepressor SMRT. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Deletion of this gene result in embryonic lethality by E11, due to vascular defects which are due to endothelial cell adhesion defects. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 78 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik G A 18: 57,533,865 G5S probably damaging Het
Acy3 A G 19: 3,988,193 E162G probably benign Het
Angptl1 T C 1: 156,845,215 S204P probably benign Het
Atf6b C T 17: 34,650,396 probably benign Het
Card11 G A 5: 140,887,101 S619F probably damaging Het
Ccl11 G A 11: 82,062,258 V81I probably damaging Het
Cds1 T C 5: 101,797,038 I126T probably damaging Het
Chd1 A G 17: 17,374,680 probably benign Het
Cndp1 C A 18: 84,618,238 V384F possibly damaging Het
Cuta A G 17: 26,939,449 probably null Het
Diaph3 G A 14: 87,115,024 T47I possibly damaging Het
Dopey1 A T 9: 86,512,639 S598C probably damaging Het
Dsp A G 13: 38,172,794 M217V probably benign Het
Esyt1 T A 10: 128,512,218 I898F possibly damaging Het
Fam189a2 G A 19: 23,979,385 probably benign Het
Fam205a1 G A 4: 42,850,236 T640M probably benign Het
Fam84b T C 15: 60,822,967 H310R probably benign Het
Fgd3 A T 13: 49,263,948 W680R possibly damaging Het
Folh1 A G 7: 86,742,165 probably benign Het
Fuk G C 8: 110,893,717 H235Q probably benign Het
Gadl1 C A 9: 116,030,738 probably benign Het
Garem1 A G 18: 21,129,612 M715T probably benign Het
Gpd2 A T 2: 57,338,955 D257V probably benign Het
Heatr5b A G 17: 78,808,453 M858T probably benign Het
Inpp4b A T 8: 82,034,516 probably benign Het
Iqgap3 G T 3: 88,096,990 C461F probably benign Het
Lamb1 C A 12: 31,326,645 C559* probably null Het
Lrrc31 T C 3: 30,684,948 N308S probably benign Het
Ly75 T C 2: 60,318,319 Y1222C probably damaging Het
Map3k10 C A 7: 27,673,900 R42L probably benign Het
Meioc A G 11: 102,672,191 T72A probably benign Het
Miox C T 15: 89,336,274 L189F possibly damaging Het
Mmp11 T C 10: 75,925,668 Y366C probably damaging Het
N4bp2 T A 5: 65,806,559 D650E probably benign Het
Ncoa6 T C 2: 155,415,701 M641V probably damaging Het
Ncoa6 TGC TGCGC 2: 155,408,291 probably null Het
Nol4l G A 2: 153,483,853 probably benign Het
Notch1 T G 2: 26,460,861 D2089A possibly damaging Het
Olfr1156 A G 2: 87,950,131 I34T probably damaging Het
Olfr1419 A G 19: 11,871,138 L26P probably damaging Het
Olfr1449 A T 19: 12,935,172 M145L probably benign Het
Olfr155 G A 4: 43,854,398 V30M possibly damaging Het
Olfr493 A G 7: 108,346,499 S161P probably benign Het
Olfr649 A T 7: 104,189,324 Y294* probably null Het
Olfr930 T A 9: 38,930,774 I201N possibly damaging Het
Otof C T 5: 30,379,533 probably null Het
Paox T C 7: 140,129,140 F324L probably damaging Het
Pycr1 A T 11: 120,640,316 I277N probably benign Het
R3hcc1l A T 19: 42,576,129 H627L probably damaging Het
Rab21 G A 10: 115,290,863 S193L probably benign Het
Ralgds T G 2: 28,550,569 probably null Het
Rbm42 A G 7: 30,645,840 S169P possibly damaging Het
Rfpl4 A G 7: 5,110,378 V262A probably benign Het
Rhobtb3 A G 13: 75,877,509 I496T possibly damaging Het
Rnf31 G A 14: 55,601,389 A901T probably damaging Het
Ryr2 T C 13: 11,716,977 D2359G probably damaging Het
Sgo2b A C 8: 63,928,789 Y336* probably null Het
Slc16a7 T A 10: 125,294,631 I62L probably benign Het
Slc22a21 A T 11: 53,959,196 probably benign Het
Slc25a21 A G 12: 56,858,025 probably null Het
Slc5a4b T C 10: 76,062,283 I532M probably damaging Het
Srrm4 C A 5: 116,467,789 probably benign Het
Stxbp1 C A 2: 32,823,542 E27D probably benign Het
Sult2a5 T A 7: 13,628,760 Y131N probably damaging Het
Svopl T C 6: 37,984,522 Q492R probably benign Het
Tmem144 G A 3: 79,839,273 probably benign Het
Tmem87a A G 2: 120,394,424 S119P probably benign Het
Tmprss11c A G 5: 86,271,430 L90P probably damaging Het
Tmprss6 T A 15: 78,452,868 D346V probably damaging Het
Ubr4 A C 4: 139,440,801 S2820R probably damaging Het
Usp4 T C 9: 108,378,564 V607A probably benign Het
Usp45 A G 4: 21,798,603 probably null Het
Vill C T 9: 119,070,827 probably benign Het
Vmn1r13 C A 6: 57,209,994 T46N probably benign Het
Vmn2r107 A G 17: 20,345,611 T63A probably benign Het
Vmn2r82 T A 10: 79,396,557 W797R probably damaging Het
Washc2 T A 6: 116,221,839 D287E probably damaging Het
Xpc G A 6: 91,498,064 L660F probably damaging Het
Other mutations in Hdac7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00435:Hdac7 APN 15 97809495 missense probably damaging 0.98
IGL01011:Hdac7 APN 15 97793935 missense possibly damaging 0.83
IGL01361:Hdac7 APN 15 97811442 missense possibly damaging 0.85
IGL01474:Hdac7 APN 15 97797939 critical splice donor site probably null
IGL02314:Hdac7 APN 15 97809004 missense probably damaging 1.00
IGL02379:Hdac7 APN 15 97808385 missense probably damaging 0.99
IGL02665:Hdac7 APN 15 97796957 unclassified probably benign
IGL03010:Hdac7 APN 15 97793929 critical splice donor site probably null
IGL03023:Hdac7 APN 15 97797957 missense probably damaging 1.00
IGL03081:Hdac7 APN 15 97798306 missense probably damaging 1.00
Cairn UTSW 15 97808495 frame shift probably null
Signpost UTSW 15 97802747 missense probably damaging 1.00
R0518:Hdac7 UTSW 15 97806499 nonsense probably null
R0521:Hdac7 UTSW 15 97806499 nonsense probably null
R0522:Hdac7 UTSW 15 97806679 splice site probably null
R1543:Hdac7 UTSW 15 97809529 splice site probably benign
R1623:Hdac7 UTSW 15 97808404 nonsense probably null
R1665:Hdac7 UTSW 15 97806525 missense probably damaging 1.00
R1844:Hdac7 UTSW 15 97807976 missense probably damaging 0.98
R1895:Hdac7 UTSW 15 97796886 missense probably damaging 1.00
R1975:Hdac7 UTSW 15 97806505 nonsense probably null
R1976:Hdac7 UTSW 15 97806505 nonsense probably null
R2038:Hdac7 UTSW 15 97798270 missense probably damaging 1.00
R2155:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2156:Hdac7 UTSW 15 97794063 missense probably benign 0.00
R2263:Hdac7 UTSW 15 97810851 critical splice donor site probably null
R3546:Hdac7 UTSW 15 97808009 missense probably damaging 1.00
R4438:Hdac7 UTSW 15 97807715 missense probably damaging 1.00
R4642:Hdac7 UTSW 15 97806516 missense probably damaging 1.00
R4704:Hdac7 UTSW 15 97796216 missense probably damaging 1.00
R4705:Hdac7 UTSW 15 97811587 missense probably damaging 0.99
R5303:Hdac7 UTSW 15 97798018 missense probably damaging 0.97
R5577:Hdac7 UTSW 15 97811455 missense probably benign 0.09
R5966:Hdac7 UTSW 15 97802491 missense probably damaging 1.00
R5974:Hdac7 UTSW 15 97802072 splice site probably null
R6270:Hdac7 UTSW 15 97808495 frame shift probably null
R6384:Hdac7 UTSW 15 97811506 nonsense probably null
R6835:Hdac7 UTSW 15 97802747 missense probably damaging 1.00
R6869:Hdac7 UTSW 15 97796176 missense probably damaging 1.00
R7261:Hdac7 UTSW 15 97806534 missense probably benign
X0028:Hdac7 UTSW 15 97809008 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGACATTGAAGCCCTCGCCAC -3'
(R):5'- GGCATGGTTACCGACCTTGAAATCC -3'

Sequencing Primer
(F):5'- TTCCCACCTGGAAAACAGGATG -3'
(R):5'- GACCTTGAAATCCTTCCACTGTG -3'
Posted On2013-04-16