Incidental Mutation 'R2358:Abcb9'
List |< first << previous [record 44 of 1259] next >> last >|
ID247005
Institutional Source Beutler Lab
Gene Symbol Abcb9
Ensembl Gene ENSMUSG00000029408
Gene NameATP-binding cassette, sub-family B (MDR/TAP), member 9
SynonymsTAPL
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R2358 (G1)
Quality Score202
Status Validated
Chromosome5
Chromosomal Location124061530-124095798 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CGG to CG at 124077305 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000031354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031354] [ENSMUST00000126856] [ENSMUST00000141510]
Predicted Effect probably null
Transcript: ENSMUST00000031354
SMART Domains Protein: ENSMUSP00000031354
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 116 138 N/A INTRINSIC
Pfam:ABC_membrane 184 453 1.9e-61 PFAM
AAA 527 713 4.07e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126856
SMART Domains Protein: ENSMUSP00000118908
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141510
SMART Domains Protein: ENSMUSP00000122969
Gene: ENSMUSG00000029408

DomainStartEndE-ValueType
transmembrane domain 7 27 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
transmembrane domain 82 104 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
transmembrane domain 181 203 N/A INTRINSIC
transmembrane domain 218 237 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148392
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153433
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196486
Meta Mutation Damage Score 0.6092 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
MGI Phenotype FUNCTION: The membrane-associated protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the MDR/TAP subfamily. Members of the MDR/TAP subfamily are involved in multidrug resistance as well as antigen presentation. The function of this half-transporter has not yet been determined; however, it may be associated with lysosome activity. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pcnx3 G A 19: 5,683,339 Q155* probably null Het
Pcnx3 C G 19: 5,683,340 L1F probably null Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Abcb9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Abcb9 APN 5 124077238 missense possibly damaging 0.90
R0045:Abcb9 UTSW 5 124082085 missense probably damaging 0.96
R0106:Abcb9 UTSW 5 124083060 missense possibly damaging 0.70
R0153:Abcb9 UTSW 5 124080056 missense probably benign 0.00
R0194:Abcb9 UTSW 5 124077295 missense probably damaging 0.99
R0458:Abcb9 UTSW 5 124082146 critical splice acceptor site probably null
R0669:Abcb9 UTSW 5 124062887 missense probably damaging 0.97
R1240:Abcb9 UTSW 5 124089921 missense probably benign 0.02
R1480:Abcb9 UTSW 5 124078826 missense probably benign 0.00
R1544:Abcb9 UTSW 5 124083631 missense probably benign
R1878:Abcb9 UTSW 5 124090136 missense probably benign 0.02
R2355:Abcb9 UTSW 5 124077305 frame shift probably null
R2520:Abcb9 UTSW 5 124080028 splice site probably null
R2926:Abcb9 UTSW 5 124078839 missense possibly damaging 0.84
R3795:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R3911:Abcb9 UTSW 5 124089846 missense probably benign 0.06
R4679:Abcb9 UTSW 5 124078804 missense probably benign 0.20
R4789:Abcb9 UTSW 5 124078790 missense probably benign 0.00
R4821:Abcb9 UTSW 5 124090149 missense probably benign 0.05
R5116:Abcb9 UTSW 5 124078867 missense probably damaging 1.00
R5804:Abcb9 UTSW 5 124080055 missense probably benign
R5997:Abcb9 UTSW 5 124089815 missense possibly damaging 0.85
R6197:Abcb9 UTSW 5 124071749 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGTTCTTACCTGTAGGACCTGTG -3'
(R):5'- ACAGTGGCGTTACATTCCCC -3'

Sequencing Primer
(F):5'- ACCTGTAGGACCTGTGTGTGG -3'
(R):5'- ATCAGTGGTAGGTGTCAG -3'
Posted On2014-10-30