Incidental Mutation 'R2358:Pcnx3'
ID247045
Institutional Source Beutler Lab
Gene Symbol Pcnx3
Ensembl Gene ENSMUSG00000054874
Gene Namepecanex homolog 3
SynonymsPcnxl3
MMRRC Submission 040340-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.210) question?
Stock #R2358 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location5664635-5688908 bp(-) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) C to G at 5683340 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 1 (L1F)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068169] [ENSMUST00000113615] [ENSMUST00000141577]
Predicted Effect probably benign
Transcript: ENSMUST00000068169
AA Change: L316F

PolyPhen 2 Score 0.084 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000063786
Gene: ENSMUSG00000054874
AA Change: L316F

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 370 376 N/A INTRINSIC
transmembrane domain 385 407 N/A INTRINSIC
transmembrane domain 411 428 N/A INTRINSIC
transmembrane domain 441 463 N/A INTRINSIC
transmembrane domain 473 492 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
transmembrane domain 538 560 N/A INTRINSIC
transmembrane domain 573 592 N/A INTRINSIC
transmembrane domain 645 667 N/A INTRINSIC
transmembrane domain 669 691 N/A INTRINSIC
low complexity region 1011 1025 N/A INTRINSIC
Pfam:Pecanex_C 1159 1389 7.5e-124 PFAM
low complexity region 1462 1479 N/A INTRINSIC
low complexity region 1481 1510 N/A INTRINSIC
low complexity region 1525 1538 N/A INTRINSIC
low complexity region 1558 1569 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113615
AA Change: L724F

PolyPhen 2 Score 0.962 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000109245
Gene: ENSMUSG00000054874
AA Change: L724F

DomainStartEndE-ValueType
transmembrane domain 36 53 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
low complexity region 99 111 N/A INTRINSIC
low complexity region 438 459 N/A INTRINSIC
low complexity region 778 784 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 819 836 N/A INTRINSIC
transmembrane domain 849 871 N/A INTRINSIC
transmembrane domain 881 900 N/A INTRINSIC
transmembrane domain 909 931 N/A INTRINSIC
transmembrane domain 946 968 N/A INTRINSIC
transmembrane domain 981 1000 N/A INTRINSIC
transmembrane domain 1053 1075 N/A INTRINSIC
transmembrane domain 1077 1099 N/A INTRINSIC
low complexity region 1419 1433 N/A INTRINSIC
Pfam:Pecanex_C 1570 1796 5.9e-116 PFAM
low complexity region 1870 1887 N/A INTRINSIC
low complexity region 1889 1918 N/A INTRINSIC
low complexity region 1933 1946 N/A INTRINSIC
low complexity region 1966 1977 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000127876
AA Change: L1F
SMART Domains Protein: ENSMUSP00000123696
Gene: ENSMUSG00000054874
AA Change: L1F

DomainStartEndE-ValueType
low complexity region 69 75 N/A INTRINSIC
transmembrane domain 84 106 N/A INTRINSIC
transmembrane domain 110 127 N/A INTRINSIC
transmembrane domain 140 162 N/A INTRINSIC
transmembrane domain 172 191 N/A INTRINSIC
transmembrane domain 200 222 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135119
Predicted Effect probably benign
Transcript: ENSMUST00000137313
SMART Domains Protein: ENSMUSP00000115217
Gene: ENSMUSG00000054874

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
transmembrane domain 44 66 N/A INTRINSIC
transmembrane domain 79 98 N/A INTRINSIC
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000141577
AA Change: L53F

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116451
Gene: ENSMUSG00000054874
AA Change: L53F

DomainStartEndE-ValueType
low complexity region 104 110 N/A INTRINSIC
transmembrane domain 119 141 N/A INTRINSIC
transmembrane domain 145 162 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
transmembrane domain 207 224 N/A INTRINSIC
transmembrane domain 229 251 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000145270
AA Change: L154F

PolyPhen 2 Score 0.640 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000116493
Gene: ENSMUSG00000054874
AA Change: L154F

DomainStartEndE-ValueType
low complexity region 199 205 N/A INTRINSIC
transmembrane domain 214 236 N/A INTRINSIC
transmembrane domain 240 257 N/A INTRINSIC
transmembrane domain 270 292 N/A INTRINSIC
transmembrane domain 302 321 N/A INTRINSIC
transmembrane domain 330 352 N/A INTRINSIC
transmembrane domain 367 389 N/A INTRINSIC
transmembrane domain 402 421 N/A INTRINSIC
transmembrane domain 474 496 N/A INTRINSIC
transmembrane domain 498 520 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147161
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184789
Meta Mutation Damage Score 0.6376 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 98% (55/56)
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 CGG CG 5: 124,077,305 probably null Het
Aif1l T A 2: 31,969,751 F94L probably damaging Het
Ankzf1 C T 1: 75,195,251 H209Y probably damaging Het
Ate1 A T 7: 130,516,165 M30K probably damaging Het
Cd27 A G 6: 125,233,318 Y189H probably damaging Het
Cela1 A G 15: 100,681,228 I183T probably benign Het
Copg2 A T 6: 30,826,233 L259* probably null Het
Efcab7 T A 4: 99,831,586 probably benign Het
Fcrl5 A G 3: 87,446,419 E357G probably damaging Het
Fzr1 C T 10: 81,367,640 probably null Het
Gm10696 G A 3: 94,175,547 A319V possibly damaging Het
Gm10696 C A 3: 94,175,548 A319S possibly damaging Het
Il12rb2 C T 6: 67,298,195 A649T probably damaging Het
Itfg1 C A 8: 85,738,129 V438F probably damaging Het
Jaml A C 9: 45,101,063 I283L possibly damaging Het
Kif28 A T 1: 179,709,459 H486Q probably damaging Het
Lrch4 A G 5: 137,638,548 probably benign Het
Lrfn2 A G 17: 49,071,160 E423G possibly damaging Het
Lrp4 T A 2: 91,501,954 N1665K probably benign Het
Mrpl32 A T 13: 14,610,580 V157E probably damaging Het
Mta3 A G 17: 83,762,988 I193V probably damaging Het
Myom2 G A 8: 15,112,018 V984I possibly damaging Het
Nedd4l G A 18: 65,209,719 V909I possibly damaging Het
Nlrp4a A G 7: 26,464,198 D930G probably benign Het
Olfr121 T A 17: 37,752,380 C175* probably null Het
Olfr1351 T C 10: 79,018,188 F289L probably damaging Het
Olfr74 A T 2: 87,973,722 N314K probably benign Het
Ovch2 A T 7: 107,794,915 H110Q probably damaging Het
Pi4k2a G A 19: 42,090,692 R64Q probably damaging Het
Ptpn12 G A 5: 20,998,692 P363S probably damaging Het
Rbm27 T C 18: 42,292,112 probably benign Het
Ripor3 A G 2: 167,983,865 probably benign Het
Rpl13-ps3 A G 14: 58,893,816 noncoding transcript Het
Sap18b G A 8: 95,825,563 R67H probably benign Het
Sdhb T C 4: 140,973,000 V137A probably damaging Het
Shmt2 T C 10: 127,518,028 T459A probably benign Het
Siglecg A G 7: 43,409,422 S200G possibly damaging Het
Slc6a15 T G 10: 103,416,785 I603S probably benign Het
Smtn A T 11: 3,532,865 probably null Het
Spata31d1a G A 13: 59,703,888 S142L probably benign Het
Spopl C T 2: 23,537,380 R221Q probably damaging Het
St5 A T 7: 109,556,446 S366T probably benign Het
Strip1 A G 3: 107,615,819 V633A probably benign Het
Sun2 A G 15: 79,727,913 S522P possibly damaging Het
Tectb C G 19: 55,180,999 probably benign Het
Terb2 T A 2: 122,198,432 C157S probably benign Het
Themis T A 10: 28,863,380 N615K possibly damaging Het
Tlnrd1 A T 7: 83,882,280 D314E probably benign Het
Vmn1r205 T A 13: 22,592,396 T179S probably benign Het
Vsig10l G A 7: 43,468,761 R689H probably benign Het
Wt1 G A 2: 105,163,428 probably benign Het
Zfp423 G T 8: 87,780,551 A1034D possibly damaging Het
Zfy2 T C Y: 2,107,272 E454G possibly damaging Het
Zyg11a G T 4: 108,196,146 Q440K possibly damaging Het
Other mutations in Pcnx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01616:Pcnx3 APN 19 5667259 unclassified probably benign
IGL01667:Pcnx3 APN 19 5686630 missense probably benign 0.03
IGL01704:Pcnx3 APN 19 5667476 missense probably damaging 1.00
IGL01752:Pcnx3 APN 19 5665337 nonsense probably null
IGL01791:Pcnx3 APN 19 5673267 missense probably benign 0.39
IGL01937:Pcnx3 APN 19 5677663 missense probably benign
IGL01987:Pcnx3 APN 19 5677479 missense probably damaging 1.00
IGL02073:Pcnx3 APN 19 5679386 missense probably damaging 0.99
IGL02417:Pcnx3 APN 19 5686481 missense possibly damaging 0.92
IGL03143:Pcnx3 APN 19 5685395 missense probably damaging 1.00
PIT4453001:Pcnx3 UTSW 19 5672756 critical splice donor site probably null
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0234:Pcnx3 UTSW 19 5672618 missense probably benign 0.12
R0360:Pcnx3 UTSW 19 5665583 missense probably damaging 0.98
R0687:Pcnx3 UTSW 19 5684333 missense probably damaging 1.00
R0718:Pcnx3 UTSW 19 5677728 splice site probably benign
R0840:Pcnx3 UTSW 19 5685701 unclassified probably null
R0907:Pcnx3 UTSW 19 5671525 missense possibly damaging 0.95
R1251:Pcnx3 UTSW 19 5677182 missense probably benign 0.03
R1373:Pcnx3 UTSW 19 5665516 missense probably damaging 0.97
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1467:Pcnx3 UTSW 19 5674894 missense possibly damaging 0.63
R1572:Pcnx3 UTSW 19 5685347 nonsense probably null
R1602:Pcnx3 UTSW 19 5672515 missense probably damaging 1.00
R1628:Pcnx3 UTSW 19 5686065 missense probably damaging 0.99
R1635:Pcnx3 UTSW 19 5665745 missense probably benign 0.00
R1670:Pcnx3 UTSW 19 5673315 missense probably damaging 1.00
R1889:Pcnx3 UTSW 19 5672656 missense probably damaging 1.00
R1898:Pcnx3 UTSW 19 5672587 missense probably damaging 1.00
R2113:Pcnx3 UTSW 19 5671556 missense possibly damaging 0.93
R2147:Pcnx3 UTSW 19 5667605 missense probably damaging 1.00
R2358:Pcnx3 UTSW 19 5683339 nonsense probably null
R2871:Pcnx3 UTSW 19 5683746 intron probably benign
R3699:Pcnx3 UTSW 19 5672465 missense probably damaging 1.00
R3712:Pcnx3 UTSW 19 5683339 nonsense probably null
R3712:Pcnx3 UTSW 19 5683340 start codon destroyed probably null
R3798:Pcnx3 UTSW 19 5678668 nonsense probably null
R3856:Pcnx3 UTSW 19 5678967 missense probably benign 0.02
R3953:Pcnx3 UTSW 19 5683780 splice site probably benign
R4613:Pcnx3 UTSW 19 5667219 missense possibly damaging 0.51
R4781:Pcnx3 UTSW 19 5687130 missense probably damaging 0.99
R4816:Pcnx3 UTSW 19 5687995 critical splice donor site probably null
R5338:Pcnx3 UTSW 19 5672596 missense probably damaging 1.00
R5770:Pcnx3 UTSW 19 5681579 intron probably benign
R5950:Pcnx3 UTSW 19 5667158 missense possibly damaging 0.81
R5951:Pcnx3 UTSW 19 5671680 missense possibly damaging 0.71
R5969:Pcnx3 UTSW 19 5685535 missense probably damaging 1.00
R6543:Pcnx3 UTSW 19 5665247 missense probably benign 0.07
R6704:Pcnx3 UTSW 19 5686487 missense possibly damaging 0.74
R7096:Pcnx3 UTSW 19 5672615 missense probably damaging 1.00
X0028:Pcnx3 UTSW 19 5684427 missense probably damaging 1.00
X0053:Pcnx3 UTSW 19 5686622 splice site probably null
Predicted Primers PCR Primer
(F):5'- AGAGTGATCTAGCCCTCTTGG -3'
(R):5'- GCCTGCAAGAGATACTTCTGC -3'

Sequencing Primer
(F):5'- ACCAGCCTTAGTCATCTG -3'
(R):5'- CCTGCAAGAGATACTTCTGCAATCTG -3'
Posted On2014-10-30