Incidental Mutation 'R2359:Smarcd2'
ID247081
Institutional Source Beutler Lab
Gene Symbol Smarcd2
Ensembl Gene ENSMUSG00000078619
Gene NameSWI/SNF related, matrix associated, actin dependent regulator of chromatin, subfamily d, member 2
SynonymsBaf60b
MMRRC Submission 040341-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.867) question?
Stock #R2359 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location106263179-106272972 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106267164 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Valine at position 93 (M93V)
Ref Sequence ENSEMBL: ENSMUSP00000102456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021049] [ENSMUST00000021052] [ENSMUST00000106843] [ENSMUST00000133131] [ENSMUST00000140255]
Predicted Effect probably benign
Transcript: ENSMUST00000021049
SMART Domains Protein: ENSMUSP00000021049
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000021052
AA Change: M140V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000021052
Gene: ENSMUSG00000078619
AA Change: M140V

DomainStartEndE-ValueType
low complexity region 5 42 N/A INTRINSIC
low complexity region 44 58 N/A INTRINSIC
low complexity region 122 131 N/A INTRINSIC
Blast:KISc 136 287 2e-36 BLAST
SWIB 307 386 1.3e-21 SMART
Blast:MYSc 468 514 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106841
Predicted Effect probably benign
Transcript: ENSMUST00000106843
AA Change: M93V

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000102456
Gene: ENSMUSG00000078619
AA Change: M93V

DomainStartEndE-ValueType
low complexity region 75 84 N/A INTRINSIC
Blast:KISc 89 240 1e-36 BLAST
SWIB 260 339 1.3e-21 SMART
Blast:MYSc 421 467 5e-11 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132278
Predicted Effect probably benign
Transcript: ENSMUST00000133131
SMART Domains Protein: ENSMUSP00000138057
Gene: ENSMUSG00000020708

DomainStartEndE-ValueType
low complexity region 57 69 N/A INTRINSIC
low complexity region 96 108 N/A INTRINSIC
AAA 182 321 6.96e-25 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000140255
SMART Domains Protein: ENSMUSP00000133629
Gene: ENSMUSG00000078619

DomainStartEndE-ValueType
SWIB 29 108 1.3e-21 SMART
Blast:MYSc 190 236 6e-12 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155243
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155514
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174253
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency 95% (41/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the SWI/SNF family of proteins, whose members display helicase and ATPase activities and which are thought to regulate transcription of certain genes by altering the chromatin structure around those genes. The encoded protein is part of the large ATP-dependent chromatin remodeling complex SNF/SWI and has sequence similarity to the yeast Swp73 protein. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aaed1 A T 13: 64,312,651 C12S probably benign Het
Adam24 A G 8: 40,680,945 E484G possibly damaging Het
Akr1c20 C T 13: 4,523,277 G13D probably damaging Het
Alkbh3 T C 2: 94,008,113 T38A probably benign Het
Anxa9 A C 3: 95,302,751 L99R probably damaging Het
Arfgef2 A T 2: 166,860,619 Y826F probably damaging Het
Arid2 G T 15: 96,361,878 L306F probably damaging Het
Ccdc141 C T 2: 77,170,402 V29M probably damaging Het
Cd55b A G 1: 130,418,121 S187P probably damaging Het
Cep63 A C 9: 102,594,564 L526V possibly damaging Het
Chtf8 G T 8: 106,885,416 S297Y probably null Het
Clca4b T A 3: 144,925,242 S286C probably damaging Het
Cpsf1 A G 15: 76,597,673 V1080A probably benign Het
Csf2rb2 C T 15: 78,292,776 V165I probably benign Het
Cyp2c40 A T 19: 39,777,954 V399E probably damaging Het
Dnmt3a T C 12: 3,901,599 S659P probably damaging Het
Efr3b G A 12: 3,980,136 probably benign Het
Epha8 A G 4: 136,946,032 I147T probably damaging Het
Fbxo48 G A 11: 16,953,602 W76* probably null Het
Ggt6 A T 11: 72,437,551 L254F possibly damaging Het
Gm11639 T C 11: 104,739,280 S967P possibly damaging Het
Gm4204 T A 1: 135,232,189 noncoding transcript Het
Golph3l A G 3: 95,591,964 probably null Het
Gtf2h3 A G 5: 124,590,876 K166R probably damaging Het
Hsp90aa1 A G 12: 110,694,569 probably null Het
Hyi A G 4: 118,360,341 R79G probably benign Het
Igbp1b G A 6: 138,657,715 P244S probably damaging Het
Ipo8 G A 6: 148,816,477 probably benign Het
Larp4b C A 13: 9,158,163 T391K probably damaging Het
Lrba T C 3: 86,348,750 V1133A probably benign Het
Med13 C T 11: 86,291,035 probably benign Het
Ncapd2 A G 6: 125,179,416 probably benign Het
Neurl1b T C 17: 26,441,595 F299L probably benign Het
Nosip G A 7: 45,074,026 A39T possibly damaging Het
Nsd1 A G 13: 55,213,711 D164G possibly damaging Het
Ntn1 G A 11: 68,385,612 T170M probably damaging Het
Polrmt A T 10: 79,736,562 L1153Q probably damaging Het
Rab30 A G 7: 92,835,797 D129G possibly damaging Het
Rwdd2b C T 16: 87,436,921 S97N probably benign Het
Slitrk3 T G 3: 73,049,345 D698A possibly damaging Het
Tmprss4 A G 9: 45,185,832 V45A probably benign Het
Vmn1r22 A T 6: 57,900,989 M1K probably null Het
Vps13a A G 19: 16,652,679 probably benign Het
Other mutations in Smarcd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Smarcd2 APN 11 106265904 missense probably damaging 1.00
IGL01880:Smarcd2 APN 11 106266677 missense probably damaging 1.00
R0357:Smarcd2 UTSW 11 106267332 critical splice donor site probably null
R0626:Smarcd2 UTSW 11 106267415 missense probably benign 0.10
R1524:Smarcd2 UTSW 11 106267152 missense probably benign 0.01
R1822:Smarcd2 UTSW 11 106267396 missense probably benign 0.00
R2072:Smarcd2 UTSW 11 106265307 nonsense probably null
R2074:Smarcd2 UTSW 11 106265307 nonsense probably null
R3960:Smarcd2 UTSW 11 106266575 missense probably damaging 1.00
R4211:Smarcd2 UTSW 11 106266905 nonsense probably null
R4258:Smarcd2 UTSW 11 106265250 missense probably damaging 1.00
R4822:Smarcd2 UTSW 11 106266531 splice site probably null
R5174:Smarcd2 UTSW 11 106267045 intron probably benign
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
R6035:Smarcd2 UTSW 11 106266889 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TATGCCTGAGACTCTGGGACAAG -3'
(R):5'- TCCGAAAACGCCTGCTTGTG -3'

Sequencing Primer
(F):5'- ACAAGCTCCCGGATCTGCAG -3'
(R):5'- GCCTGCTTGTGCCTCAG -3'
Posted On2014-10-30