Incidental Mutation 'R2360:2810474O19Rik'
ID247106
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 040342-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2360 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 149334647 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Methionine at position 1488 (I1488M)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000189837] [ENSMUST00000189932]
Predicted Effect probably benign
Transcript: ENSMUST00000046689
AA Change: I1488M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: I1488M

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000100765
AA Change: I1488M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: I1488M

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189837
AA Change: I1486M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: I1486M

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000189932
AA Change: I1488M

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: I1488M

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Meta Mutation Damage Score 0.1576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik A T 7: 29,574,789 noncoding transcript Het
Abca14 A G 7: 120,251,208 E761G probably benign Het
Apc C T 18: 34,261,126 T35I probably damaging Het
Arhgef2 T A 3: 88,634,416 I228N probably damaging Het
Atp6v1g2 A G 17: 35,237,662 E74G probably damaging Het
C330027C09Rik C T 16: 49,017,465 Q843* probably null Het
Ccdc70 A G 8: 21,973,431 E79G probably damaging Het
Cdc42ep4 A G 11: 113,728,702 S288P probably damaging Het
Cpn2 T C 16: 30,259,503 D460G probably benign Het
Crtam A G 9: 40,973,515 *393Q probably null Het
Cwc22 A G 2: 77,927,247 I179T probably damaging Het
Cyp3a41b T C 5: 145,570,411 M240V probably benign Het
Dnah8 A T 17: 30,677,204 D864V probably benign Het
Map3k7 T C 4: 31,964,302 S14P unknown Het
Med25 A G 7: 44,885,142 S150P probably damaging Het
Mex3b T C 7: 82,867,862 V71A probably benign Het
Morc3 T C 16: 93,841,387 L19S probably damaging Het
Morn1 T A 4: 155,092,313 S98T probably damaging Het
Mthfd1l G T 10: 4,056,771 A678S probably damaging Het
Napa A G 7: 16,114,158 Y200C probably damaging Het
Nr5a2 T C 1: 136,948,827 I33V probably benign Het
Olfr127 A G 17: 37,904,454 K303E possibly damaging Het
Pcnx A G 12: 81,950,186 D952G probably damaging Het
Phf20l1 G A 15: 66,594,920 R66Q probably damaging Het
Rfk A G 19: 17,398,596 T85A probably benign Het
Sbno2 T C 10: 80,058,021 D1179G possibly damaging Het
Serpina3k C T 12: 104,340,907 Q133* probably null Het
Setd4 T C 16: 93,586,234 probably benign Het
Sh2d4b C T 14: 40,860,591 probably null Het
Slc1a6 G A 10: 78,812,884 V480I possibly damaging Het
Slc39a3 A T 10: 81,031,270 V214E possibly damaging Het
Tll1 A G 8: 64,051,401 Y654H probably damaging Het
Traf3ip1 T A 1: 91,499,652 C115S unknown Het
Vmn1r209 T A 13: 22,805,666 I285F probably damaging Het
Vmn2r87 G T 10: 130,479,762 T145K probably damaging Het
Zan T C 5: 137,396,126 T4484A unknown Het
Zfp768 T C 7: 127,344,638 E106G probably benign Het
Zfp984 A G 4: 147,754,777 I539T possibly damaging Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4385:2810474O19Rik UTSW 6 149326208 missense possibly damaging 0.93
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ATGTGTATATATGGCAGGGGAGG -3'
(R):5'- TTTCTGCAAGGGAGCCTGAA -3'

Sequencing Primer
(F):5'- TTGCCGTGAAACTCAGACTG -3'
(R):5'- AAAGAAAAGACTAGGGGTGTTCTC -3'
Posted On2014-10-30