Incidental Mutation 'R2360:4930432E11Rik'
ID 247108
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene Name RIKEN cDNA 4930432E11 gene
Synonyms
MMRRC Submission 040342-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.073) question?
Stock # R2360 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 29255998-29276204 bp(+) (GRCm39)
Type of Mutation unclassified
DNA Base Change (assembly) A to T at 29274214 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
AlphaFold no structure available at present
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187265
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency 93% (37/40)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca14 A G 7: 119,850,431 (GRCm39) E761G probably benign Het
Apc C T 18: 34,394,179 (GRCm39) T35I probably damaging Het
Arhgef2 T A 3: 88,541,723 (GRCm39) I228N probably damaging Het
Atp6v1g2 A G 17: 35,456,638 (GRCm39) E74G probably damaging Het
Ccdc70 A G 8: 22,463,447 (GRCm39) E79G probably damaging Het
Cdc42ep4 A G 11: 113,619,528 (GRCm39) S288P probably damaging Het
Cip2a C T 16: 48,837,828 (GRCm39) Q843* probably null Het
Cpn2 T C 16: 30,078,321 (GRCm39) D460G probably benign Het
Crtam A G 9: 40,884,811 (GRCm39) *393Q probably null Het
Cwc22 A G 2: 77,757,591 (GRCm39) I179T probably damaging Het
Cyp3a41b T C 5: 145,507,221 (GRCm39) M240V probably benign Het
Dnah8 A T 17: 30,896,178 (GRCm39) D864V probably benign Het
Map3k7 T C 4: 31,964,302 (GRCm39) S14P unknown Het
Med25 A G 7: 44,534,566 (GRCm39) S150P probably damaging Het
Mex3b T C 7: 82,517,070 (GRCm39) V71A probably benign Het
Morc3 T C 16: 93,638,275 (GRCm39) L19S probably damaging Het
Morn1 T A 4: 155,176,770 (GRCm39) S98T probably damaging Het
Mthfd1l G T 10: 4,006,771 (GRCm39) A678S probably damaging Het
Napa A G 7: 15,848,083 (GRCm39) Y200C probably damaging Het
Nr5a2 T C 1: 136,876,565 (GRCm39) I33V probably benign Het
Or14j6 A G 17: 38,215,345 (GRCm39) K303E possibly damaging Het
Pcnx1 A G 12: 81,996,960 (GRCm39) D952G probably damaging Het
Phf20l1 G A 15: 66,466,769 (GRCm39) R66Q probably damaging Het
Resf1 A G 6: 149,236,145 (GRCm39) I1488M probably benign Het
Rfk A G 19: 17,375,960 (GRCm39) T85A probably benign Het
Sbno2 T C 10: 79,893,855 (GRCm39) D1179G possibly damaging Het
Serpina3k C T 12: 104,307,166 (GRCm39) Q133* probably null Het
Setd4 T C 16: 93,383,122 (GRCm39) probably benign Het
Sh2d4b C T 14: 40,582,548 (GRCm39) probably null Het
Slc1a6 G A 10: 78,648,718 (GRCm39) V480I possibly damaging Het
Slc39a3 A T 10: 80,867,104 (GRCm39) V214E possibly damaging Het
Tll1 A G 8: 64,504,435 (GRCm39) Y654H probably damaging Het
Traf3ip1 T A 1: 91,427,374 (GRCm39) C115S unknown Het
Vmn1r209 T A 13: 22,989,836 (GRCm39) I285F probably damaging Het
Vmn2r87 G T 10: 130,315,631 (GRCm39) T145K probably damaging Het
Zan T C 5: 137,394,388 (GRCm39) T4484A unknown Het
Zfp768 T C 7: 126,943,810 (GRCm39) E106G probably benign Het
Zfp984 A G 4: 147,839,234 (GRCm39) I539T possibly damaging Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29,273,426 (GRCm39) unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29,273,420 (GRCm39) unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29,273,987 (GRCm39) unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29,262,704 (GRCm39) unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29,262,777 (GRCm39) unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29,262,537 (GRCm39) unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29,278,526 (GRCm39) exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29,273,595 (GRCm39) unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29,260,236 (GRCm39) exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29,274,027 (GRCm39) unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29,261,825 (GRCm39) exon noncoding transcript
R0478:4930432E11Rik UTSW 7 29,262,014 (GRCm39) exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29,260,710 (GRCm39) exon noncoding transcript
R1208:4930432E11Rik UTSW 7 29,260,708 (GRCm39) exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29,260,131 (GRCm39) exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29,278,591 (GRCm39) exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29,273,514 (GRCm39) unclassified noncoding transcript
R3736:4930432E11Rik UTSW 7 29,273,996 (GRCm39) unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29,260,263 (GRCm39) exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29,278,678 (GRCm39) exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29,274,326 (GRCm39) unclassified noncoding transcript
R4929:4930432E11Rik UTSW 7 29,273,467 (GRCm39) unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29,273,927 (GRCm39) unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29,260,786 (GRCm39) exon noncoding transcript
R5371:4930432E11Rik UTSW 7 29,261,918 (GRCm39) exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29,262,393 (GRCm39) unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29,277,153 (GRCm39) unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29,280,610 (GRCm39) exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- AATGCCAGAGCTGCCTCTTG -3'
(R):5'- CCATGTCTTTGTCTAGCTCAGTAGG -3'

Sequencing Primer
(F):5'- TCTTGGCTCTGACAAAATCCAGG -3'
(R):5'- GCTCAGTAGGAGGTGGTAATTTC -3'
Posted On 2014-10-30